ID: 1019164521

View in Genome Browser
Species Human (GRCh38)
Location 6:170089053-170089075
Sequence GGCTAACTTTTTTTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019164521_1019164525 -8 Left 1019164521 6:170089053-170089075 CCTGTCTCTAAAAAAAGTTAGCC No data
Right 1019164525 6:170089068-170089090 AGTTAGCCAGGCGTGGTGGTTGG No data
1019164521_1019164528 18 Left 1019164521 6:170089053-170089075 CCTGTCTCTAAAAAAAGTTAGCC No data
Right 1019164528 6:170089094-170089116 TATAGTCCCAGCTACTCAGGAGG No data
1019164521_1019164530 24 Left 1019164521 6:170089053-170089075 CCTGTCTCTAAAAAAAGTTAGCC No data
Right 1019164530 6:170089100-170089122 CCCAGCTACTCAGGAGGCTGAGG No data
1019164521_1019164532 28 Left 1019164521 6:170089053-170089075 CCTGTCTCTAAAAAAAGTTAGCC No data
Right 1019164532 6:170089104-170089126 GCTACTCAGGAGGCTGAGGCAGG No data
1019164521_1019164527 15 Left 1019164521 6:170089053-170089075 CCTGTCTCTAAAAAAAGTTAGCC No data
Right 1019164527 6:170089091-170089113 TGCTATAGTCCCAGCTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019164521 Original CRISPR GGCTAACTTTTTTTAGAGAC AGG (reversed) Intergenic