ID: 1019164605

View in Genome Browser
Species Human (GRCh38)
Location 6:170089738-170089760
Sequence GCTCAGGCCCAGACCGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019164605_1019164610 -7 Left 1019164605 6:170089738-170089760 CCTTCTGCGGTCTGGGCCTGAGC No data
Right 1019164610 6:170089754-170089776 CCTGAGCTTTGTGGTCTGGCGGG No data
1019164605_1019164611 -6 Left 1019164605 6:170089738-170089760 CCTTCTGCGGTCTGGGCCTGAGC No data
Right 1019164611 6:170089755-170089777 CTGAGCTTTGTGGTCTGGCGGGG No data
1019164605_1019164608 -8 Left 1019164605 6:170089738-170089760 CCTTCTGCGGTCTGGGCCTGAGC No data
Right 1019164608 6:170089753-170089775 GCCTGAGCTTTGTGGTCTGGCGG No data
1019164605_1019164613 5 Left 1019164605 6:170089738-170089760 CCTTCTGCGGTCTGGGCCTGAGC No data
Right 1019164613 6:170089766-170089788 GGTCTGGCGGGGCCTTGGCCAGG No data
1019164605_1019164612 0 Left 1019164605 6:170089738-170089760 CCTTCTGCGGTCTGGGCCTGAGC No data
Right 1019164612 6:170089761-170089783 TTTGTGGTCTGGCGGGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019164605 Original CRISPR GCTCAGGCCCAGACCGCAGA AGG (reversed) Intergenic
No off target data available for this crispr