ID: 1019165923

View in Genome Browser
Species Human (GRCh38)
Location 6:170097553-170097575
Sequence CACGGGAATCAGGGTCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019165923_1019165926 -8 Left 1019165923 6:170097553-170097575 CCTGCGGGACCCTGATTCCCGTG No data
Right 1019165926 6:170097568-170097590 TTCCCGTGTCACCCTTGCTCAGG No data
1019165923_1019165934 27 Left 1019165923 6:170097553-170097575 CCTGCGGGACCCTGATTCCCGTG No data
Right 1019165934 6:170097603-170097625 CGACACCTGGAACTGACTCCAGG No data
1019165923_1019165932 14 Left 1019165923 6:170097553-170097575 CCTGCGGGACCCTGATTCCCGTG No data
Right 1019165932 6:170097590-170097612 GAAACAAAGGAGCCGACACCTGG No data
1019165923_1019165929 1 Left 1019165923 6:170097553-170097575 CCTGCGGGACCCTGATTCCCGTG No data
Right 1019165929 6:170097577-170097599 CACCCTTGCTCAGGAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019165923 Original CRISPR CACGGGAATCAGGGTCCCGC AGG (reversed) Intergenic
No off target data available for this crispr