ID: 1019166020

View in Genome Browser
Species Human (GRCh38)
Location 6:170098050-170098072
Sequence CCCCATGAGCACACACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019166018_1019166020 -2 Left 1019166018 6:170098029-170098051 CCAGCAGAGTCAGTACATGCTCC No data
Right 1019166020 6:170098050-170098072 CCCCATGAGCACACACACCCAGG No data
1019166014_1019166020 10 Left 1019166014 6:170098017-170098039 CCACCAGTGACCCCAGCAGAGTC No data
Right 1019166020 6:170098050-170098072 CCCCATGAGCACACACACCCAGG No data
1019166015_1019166020 7 Left 1019166015 6:170098020-170098042 CCAGTGACCCCAGCAGAGTCAGT No data
Right 1019166020 6:170098050-170098072 CCCCATGAGCACACACACCCAGG No data
1019166016_1019166020 0 Left 1019166016 6:170098027-170098049 CCCCAGCAGAGTCAGTACATGCT No data
Right 1019166020 6:170098050-170098072 CCCCATGAGCACACACACCCAGG No data
1019166017_1019166020 -1 Left 1019166017 6:170098028-170098050 CCCAGCAGAGTCAGTACATGCTC No data
Right 1019166020 6:170098050-170098072 CCCCATGAGCACACACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019166020 Original CRISPR CCCCATGAGCACACACACCC AGG Intergenic
No off target data available for this crispr