ID: 1019166289

View in Genome Browser
Species Human (GRCh38)
Location 6:170099727-170099749
Sequence GACGCAGCTTCCTCTCCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019166289_1019166290 23 Left 1019166289 6:170099727-170099749 CCACACGGAGAGGAAGCTGCGTC No data
Right 1019166290 6:170099773-170099795 CTGCCCACGCTCCTACTTAATGG No data
1019166289_1019166291 24 Left 1019166289 6:170099727-170099749 CCACACGGAGAGGAAGCTGCGTC No data
Right 1019166291 6:170099774-170099796 TGCCCACGCTCCTACTTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019166289 Original CRISPR GACGCAGCTTCCTCTCCGTG TGG (reversed) Intergenic
No off target data available for this crispr