ID: 1019167761

View in Genome Browser
Species Human (GRCh38)
Location 6:170110309-170110331
Sequence GCTGCAGACCCGTCCTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019167761_1019167771 13 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167771 6:170110345-170110367 GCACACAGGGACAGAGTGCCAGG No data
1019167761_1019167774 23 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167774 6:170110355-170110377 ACAGAGTGCCAGGGTGGTCCCGG No data
1019167761_1019167765 -1 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167765 6:170110331-170110353 CCCTGGTCCCCGCGGCACACAGG No data
1019167761_1019167767 0 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167767 6:170110332-170110354 CCTGGTCCCCGCGGCACACAGGG No data
1019167761_1019167775 24 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167775 6:170110356-170110378 CAGAGTGCCAGGGTGGTCCCGGG No data
1019167761_1019167772 14 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167772 6:170110346-170110368 CACACAGGGACAGAGTGCCAGGG No data
1019167761_1019167763 -9 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167763 6:170110323-170110345 GTCTGCAGCCCTGGTCCCCGCGG No data
1019167761_1019167773 17 Left 1019167761 6:170110309-170110331 CCTCTTCAGGACGGGTCTGCAGC No data
Right 1019167773 6:170110349-170110371 ACAGGGACAGAGTGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019167761 Original CRISPR GCTGCAGACCCGTCCTGAAG AGG (reversed) Intergenic
No off target data available for this crispr