ID: 1019167874

View in Genome Browser
Species Human (GRCh38)
Location 6:170110854-170110876
Sequence TCTCACCTGCAGAAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019167866_1019167874 23 Left 1019167866 6:170110808-170110830 CCAGCCTTGTCGGGCGGCCACGC No data
Right 1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG No data
1019167865_1019167874 24 Left 1019167865 6:170110807-170110829 CCCAGCCTTGTCGGGCGGCCACG No data
Right 1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG No data
1019167863_1019167874 29 Left 1019167863 6:170110802-170110824 CCGATCCCAGCCTTGTCGGGCGG No data
Right 1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG No data
1019167870_1019167874 6 Left 1019167870 6:170110825-170110847 CCACGCGCTTTTGCAGGGTGTGT No data
Right 1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG No data
1019167867_1019167874 19 Left 1019167867 6:170110812-170110834 CCTTGTCGGGCGGCCACGCGCTT No data
Right 1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019167874 Original CRISPR TCTCACCTGCAGAAGGAGGC GGG Intergenic
No off target data available for this crispr