ID: 1019168165

View in Genome Browser
Species Human (GRCh38)
Location 6:170112749-170112771
Sequence CCTACACCACAGGTGCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019168162_1019168165 5 Left 1019168162 6:170112721-170112743 CCACAGGTGTGTGGTGGGAACTG No data
Right 1019168165 6:170112749-170112771 CCTACACCACAGGTGCCCAATGG No data
1019168158_1019168165 11 Left 1019168158 6:170112715-170112737 CCGCACCCACAGGTGTGTGGTGG No data
Right 1019168165 6:170112749-170112771 CCTACACCACAGGTGCCCAATGG No data
1019168161_1019168165 6 Left 1019168161 6:170112720-170112742 CCCACAGGTGTGTGGTGGGAACT No data
Right 1019168165 6:170112749-170112771 CCTACACCACAGGTGCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019168165 Original CRISPR CCTACACCACAGGTGCCCAA TGG Intergenic