ID: 1019169447

View in Genome Browser
Species Human (GRCh38)
Location 6:170123970-170123992
Sequence GCTGCTGTGGTGCCAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019169447_1019169455 7 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169455 6:170124000-170124022 GACAGCTGGGGCTGCGGCACAGG No data
1019169447_1019169454 1 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169454 6:170123994-170124016 TTCATGGACAGCTGGGGCTGCGG No data
1019169447_1019169452 -5 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169452 6:170123988-170124010 GCAGCCTTCATGGACAGCTGGGG No data
1019169447_1019169450 -7 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169450 6:170123986-170124008 CAGCAGCCTTCATGGACAGCTGG No data
1019169447_1019169457 22 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169457 6:170124015-170124037 GGCACAGGGAACAGAAAAAGTGG No data
1019169447_1019169456 8 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169456 6:170124001-170124023 ACAGCTGGGGCTGCGGCACAGGG No data
1019169447_1019169451 -6 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169451 6:170123987-170124009 AGCAGCCTTCATGGACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019169447 Original CRISPR GCTGCTGTGGTGCCAGCAGC AGG (reversed) Intergenic
No off target data available for this crispr