ID: 1019169451

View in Genome Browser
Species Human (GRCh38)
Location 6:170123987-170124009
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019169447_1019169451 -6 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169451 6:170123987-170124009 AGCAGCCTTCATGGACAGCTGGG No data
1019169444_1019169451 8 Left 1019169444 6:170123956-170123978 CCCTGTGGGTTACTCCTGCTGCT No data
Right 1019169451 6:170123987-170124009 AGCAGCCTTCATGGACAGCTGGG No data
1019169445_1019169451 7 Left 1019169445 6:170123957-170123979 CCTGTGGGTTACTCCTGCTGCTG No data
Right 1019169451 6:170123987-170124009 AGCAGCCTTCATGGACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019169451 Original CRISPR AGCAGCCTTCATGGACAGCT GGG Intergenic
No off target data available for this crispr