ID: 1019169457

View in Genome Browser
Species Human (GRCh38)
Location 6:170124015-170124037
Sequence GGCACAGGGAACAGAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019169453_1019169457 0 Left 1019169453 6:170123992-170124014 CCTTCATGGACAGCTGGGGCTGC No data
Right 1019169457 6:170124015-170124037 GGCACAGGGAACAGAAAAAGTGG No data
1019169449_1019169457 9 Left 1019169449 6:170123983-170124005 CCACAGCAGCCTTCATGGACAGC No data
Right 1019169457 6:170124015-170124037 GGCACAGGGAACAGAAAAAGTGG No data
1019169447_1019169457 22 Left 1019169447 6:170123970-170123992 CCTGCTGCTGGCACCACAGCAGC No data
Right 1019169457 6:170124015-170124037 GGCACAGGGAACAGAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019169457 Original CRISPR GGCACAGGGAACAGAAAAAG TGG Intergenic
No off target data available for this crispr