ID: 1019170966

View in Genome Browser
Species Human (GRCh38)
Location 6:170133015-170133037
Sequence ATTTGGGCAGGTGCCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019170961_1019170966 1 Left 1019170961 6:170132991-170133013 CCAGCTCGTGCTTCTCATCAGCG No data
Right 1019170966 6:170133015-170133037 ATTTGGGCAGGTGCCTCAGTGGG No data
1019170959_1019170966 21 Left 1019170959 6:170132971-170132993 CCTCAGTGGGTAGAGGAGACCCA No data
Right 1019170966 6:170133015-170133037 ATTTGGGCAGGTGCCTCAGTGGG No data
1019170960_1019170966 2 Left 1019170960 6:170132990-170133012 CCCAGCTCGTGCTTCTCATCAGC No data
Right 1019170966 6:170133015-170133037 ATTTGGGCAGGTGCCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019170966 Original CRISPR ATTTGGGCAGGTGCCTCAGT GGG Intergenic