ID: 1019171665

View in Genome Browser
Species Human (GRCh38)
Location 6:170136463-170136485
Sequence CCGGAGAAGGCTCTGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019171665_1019171672 -6 Left 1019171665 6:170136463-170136485 CCCCTCCACAGAGCCTTCTCCGG No data
Right 1019171672 6:170136480-170136502 CTCCGGGAGCCCCGCCACCCCGG No data
1019171665_1019171673 -5 Left 1019171665 6:170136463-170136485 CCCCTCCACAGAGCCTTCTCCGG No data
Right 1019171673 6:170136481-170136503 TCCGGGAGCCCCGCCACCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019171665 Original CRISPR CCGGAGAAGGCTCTGTGGAG GGG (reversed) Intergenic
No off target data available for this crispr