ID: 1019175170

View in Genome Browser
Species Human (GRCh38)
Location 6:170155722-170155744
Sequence CTAGGTGAGCAGTGGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019175163_1019175170 19 Left 1019175163 6:170155680-170155702 CCGATTCTCTTCAGGAGGAGGTG No data
Right 1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG No data
1019175162_1019175170 20 Left 1019175162 6:170155679-170155701 CCCGATTCTCTTCAGGAGGAGGT No data
Right 1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG No data
1019175160_1019175170 21 Left 1019175160 6:170155678-170155700 CCCCGATTCTCTTCAGGAGGAGG No data
Right 1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG No data
1019175166_1019175170 -7 Left 1019175166 6:170155706-170155728 CCTGCCTCACAGAGGACTAGGTG No data
Right 1019175170 6:170155722-170155744 CTAGGTGAGCAGTGGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019175170 Original CRISPR CTAGGTGAGCAGTGGATGCA GGG Intergenic
No off target data available for this crispr