ID: 1019176781

View in Genome Browser
Species Human (GRCh38)
Location 6:170163466-170163488
Sequence CAGGGAAAGCACTGTGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019176770_1019176781 22 Left 1019176770 6:170163421-170163443 CCTGCAGTCACCACAGCGGAGCC No data
Right 1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG No data
1019176774_1019176781 1 Left 1019176774 6:170163442-170163464 CCTGTAGGAATGAGGCAGAAAAG No data
Right 1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG No data
1019176772_1019176781 12 Left 1019176772 6:170163431-170163453 CCACAGCGGAGCCTGTAGGAATG No data
Right 1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019176781 Original CRISPR CAGGGAAAGCACTGTGGGGA CGG Intergenic
No off target data available for this crispr