ID: 1019176999

View in Genome Browser
Species Human (GRCh38)
Location 6:170165116-170165138
Sequence CAGAGCCAGCACAAGGGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019176992_1019176999 5 Left 1019176992 6:170165088-170165110 CCCACAGTGACCTGGCATGAGGT No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data
1019176993_1019176999 4 Left 1019176993 6:170165089-170165111 CCACAGTGACCTGGCATGAGGTC No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data
1019176994_1019176999 -5 Left 1019176994 6:170165098-170165120 CCTGGCATGAGGTCCAGCCAGAG No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data
1019176987_1019176999 16 Left 1019176987 6:170165077-170165099 CCGGGGCCATCCCCACAGTGACC No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data
1019176990_1019176999 6 Left 1019176990 6:170165087-170165109 CCCCACAGTGACCTGGCATGAGG No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data
1019176985_1019176999 23 Left 1019176985 6:170165070-170165092 CCCTTTTCCGGGGCCATCCCCAC No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data
1019176986_1019176999 22 Left 1019176986 6:170165071-170165093 CCTTTTCCGGGGCCATCCCCACA No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data
1019176989_1019176999 10 Left 1019176989 6:170165083-170165105 CCATCCCCACAGTGACCTGGCAT No data
Right 1019176999 6:170165116-170165138 CAGAGCCAGCACAAGGGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019176999 Original CRISPR CAGAGCCAGCACAAGGGACC CGG Intergenic
No off target data available for this crispr