ID: 1019177613

View in Genome Browser
Species Human (GRCh38)
Location 6:170168197-170168219
Sequence CGGGTTGTTACTGCCTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177606_1019177613 18 Left 1019177606 6:170168156-170168178 CCGGGTTGTTACTGCCTGCTCAG No data
Right 1019177613 6:170168197-170168219 CGGGTTGTTACTGCCTGTTCAGG No data
1019177609_1019177613 4 Left 1019177609 6:170168170-170168192 CCTGCTCAGGGTTGTTACTCTCT No data
Right 1019177613 6:170168197-170168219 CGGGTTGTTACTGCCTGTTCAGG No data
1019177605_1019177613 24 Left 1019177605 6:170168150-170168172 CCTGTTCCGGGTTGTTACTGCCT No data
Right 1019177613 6:170168197-170168219 CGGGTTGTTACTGCCTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177613 Original CRISPR CGGGTTGTTACTGCCTGTTC AGG Intergenic
No off target data available for this crispr