ID: 1019177837

View in Genome Browser
Species Human (GRCh38)
Location 6:170169500-170169522
Sequence GAGAGGAACCCCGAAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177837_1019177842 4 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177842 6:170169527-170169549 CGGGGTTGTTCCTGCCTGTTCGG No data
1019177837_1019177848 25 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177848 6:170169548-170169570 GGGGTTGTTACAGCCTATTTGGG No data
1019177837_1019177844 6 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177844 6:170169529-170169551 GGGTTGTTCCTGCCTGTTCGGGG No data
1019177837_1019177847 24 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177847 6:170169547-170169569 CGGGGTTGTTACAGCCTATTTGG No data
1019177837_1019177843 5 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177843 6:170169528-170169550 GGGGTTGTTCCTGCCTGTTCGGG No data
1019177837_1019177849 26 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177849 6:170169549-170169571 GGGTTGTTACAGCCTATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177837 Original CRISPR GAGAGGAACCCCGAAAAGAG AGG (reversed) Intergenic
No off target data available for this crispr