ID: 1019177841

View in Genome Browser
Species Human (GRCh38)
Location 6:170169517-170169539
Sequence AGGAACAACCCCGAACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177841_1019177851 27 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177851 6:170169567-170169589 TGGGGTTATTACTCTCTGTTTGG No data
1019177841_1019177852 28 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177852 6:170169568-170169590 GGGGTTATTACTCTCTGTTTGGG No data
1019177841_1019177847 7 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177847 6:170169547-170169569 CGGGGTTGTTACAGCCTATTTGG No data
1019177841_1019177849 9 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177849 6:170169549-170169571 GGGTTGTTACAGCCTATTTGGGG No data
1019177841_1019177853 29 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177853 6:170169569-170169591 GGGTTATTACTCTCTGTTTGGGG No data
1019177841_1019177848 8 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177848 6:170169548-170169570 GGGGTTGTTACAGCCTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177841 Original CRISPR AGGAACAACCCCGAACAGAG AGG (reversed) Intergenic