ID: 1019177844

View in Genome Browser
Species Human (GRCh38)
Location 6:170169529-170169551
Sequence GGGTTGTTCCTGCCTGTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177833_1019177844 26 Left 1019177833 6:170169480-170169502 CCTCTCTGTTCGGTGTTGTTCCT No data
Right 1019177844 6:170169529-170169551 GGGTTGTTCCTGCCTGTTCGGGG No data
1019177837_1019177844 6 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177844 6:170169529-170169551 GGGTTGTTCCTGCCTGTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177844 Original CRISPR GGGTTGTTCCTGCCTGTTCG GGG Intergenic