ID: 1019177848 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:170169548-170169570 |
Sequence | GGGGTTGTTACAGCCTATTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1019177837_1019177848 | 25 | Left | 1019177837 | 6:170169500-170169522 | CCTCTCTTTTCGGGGTTCCTCTC | No data | ||
Right | 1019177848 | 6:170169548-170169570 | GGGGTTGTTACAGCCTATTTGGG | No data | ||||
1019177841_1019177848 | 8 | Left | 1019177841 | 6:170169517-170169539 | CCTCTCTGTTCGGGGTTGTTCCT | No data | ||
Right | 1019177848 | 6:170169548-170169570 | GGGGTTGTTACAGCCTATTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1019177848 | Original CRISPR | GGGGTTGTTACAGCCTATTT GGG | Intergenic | ||