ID: 1019177848

View in Genome Browser
Species Human (GRCh38)
Location 6:170169548-170169570
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177837_1019177848 25 Left 1019177837 6:170169500-170169522 CCTCTCTTTTCGGGGTTCCTCTC No data
Right 1019177848 6:170169548-170169570 GGGGTTGTTACAGCCTATTTGGG No data
1019177841_1019177848 8 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177848 6:170169548-170169570 GGGGTTGTTACAGCCTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177848 Original CRISPR GGGGTTGTTACAGCCTATTT GGG Intergenic