ID: 1019177852

View in Genome Browser
Species Human (GRCh38)
Location 6:170169568-170169590
Sequence GGGGTTATTACTCTCTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177845_1019177852 8 Left 1019177845 6:170169537-170169559 CCTGCCTGTTCGGGGTTGTTACA No data
Right 1019177852 6:170169568-170169590 GGGGTTATTACTCTCTGTTTGGG No data
1019177841_1019177852 28 Left 1019177841 6:170169517-170169539 CCTCTCTGTTCGGGGTTGTTCCT No data
Right 1019177852 6:170169568-170169590 GGGGTTATTACTCTCTGTTTGGG No data
1019177846_1019177852 4 Left 1019177846 6:170169541-170169563 CCTGTTCGGGGTTGTTACAGCCT No data
Right 1019177852 6:170169568-170169590 GGGGTTATTACTCTCTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177852 Original CRISPR GGGGTTATTACTCTCTGTTT GGG Intergenic