ID: 1019177899

View in Genome Browser
Species Human (GRCh38)
Location 6:170169841-170169863
Sequence AGAGAGGAACAACCCCGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177899_1019177908 24 Left 1019177899 6:170169841-170169863 CCTGTTCGGGGTTGTTCCTCTCT No data
Right 1019177908 6:170169888-170169910 GGGATTGTTCCTGCCTGTTCGGG No data
1019177899_1019177907 23 Left 1019177899 6:170169841-170169863 CCTGTTCGGGGTTGTTCCTCTCT No data
Right 1019177907 6:170169887-170169909 CGGGATTGTTCCTGCCTGTTCGG No data
1019177899_1019177904 3 Left 1019177899 6:170169841-170169863 CCTGTTCGGGGTTGTTCCTCTCT No data
Right 1019177904 6:170169867-170169889 TGGGGTTGTTCCTGACTGTTCGG No data
1019177899_1019177905 4 Left 1019177899 6:170169841-170169863 CCTGTTCGGGGTTGTTCCTCTCT No data
Right 1019177905 6:170169868-170169890 GGGGTTGTTCCTGACTGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177899 Original CRISPR AGAGAGGAACAACCCCGAAC AGG (reversed) Intergenic