ID: 1019177903

View in Genome Browser
Species Human (GRCh38)
Location 6:170169857-170169879
Sequence AGGAACAACCCCAAACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177903_1019177907 7 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177907 6:170169887-170169909 CGGGATTGTTCCTGCCTGTTCGG No data
1019177903_1019177913 29 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177913 6:170169909-170169931 GGATTGTTCCTGCCTGTTCGGGG No data
1019177903_1019177912 28 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177912 6:170169908-170169930 GGGATTGTTCCTGCCTGTTCGGG No data
1019177903_1019177908 8 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177908 6:170169888-170169910 GGGATTGTTCCTGCCTGTTCGGG No data
1019177903_1019177911 27 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177911 6:170169907-170169929 CGGGATTGTTCCTGCCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177903 Original CRISPR AGGAACAACCCCAAACAGAG AGG (reversed) Intergenic