ID: 1019177906

View in Genome Browser
Species Human (GRCh38)
Location 6:170169877-170169899
Sequence AGGAACAATCCCGAACAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177906_1019177911 7 Left 1019177906 6:170169877-170169899 CCTGACTGTTCGGGATTGTTCCT No data
Right 1019177911 6:170169907-170169929 CGGGATTGTTCCTGCCTGTTCGG No data
1019177906_1019177913 9 Left 1019177906 6:170169877-170169899 CCTGACTGTTCGGGATTGTTCCT No data
Right 1019177913 6:170169909-170169931 GGATTGTTCCTGCCTGTTCGGGG No data
1019177906_1019177912 8 Left 1019177906 6:170169877-170169899 CCTGACTGTTCGGGATTGTTCCT No data
Right 1019177912 6:170169908-170169930 GGGATTGTTCCTGCCTGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177906 Original CRISPR AGGAACAATCCCGAACAGTC AGG (reversed) Intergenic