ID: 1019177907

View in Genome Browser
Species Human (GRCh38)
Location 6:170169887-170169909
Sequence CGGGATTGTTCCTGCCTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177903_1019177907 7 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177907 6:170169887-170169909 CGGGATTGTTCCTGCCTGTTCGG No data
1019177899_1019177907 23 Left 1019177899 6:170169841-170169863 CCTGTTCGGGGTTGTTCCTCTCT No data
Right 1019177907 6:170169887-170169909 CGGGATTGTTCCTGCCTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177907 Original CRISPR CGGGATTGTTCCTGCCTGTT CGG Intergenic