ID: 1019177912

View in Genome Browser
Species Human (GRCh38)
Location 6:170169908-170169930
Sequence GGGATTGTTCCTGCCTGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177903_1019177912 28 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177912 6:170169908-170169930 GGGATTGTTCCTGCCTGTTCGGG No data
1019177906_1019177912 8 Left 1019177906 6:170169877-170169899 CCTGACTGTTCGGGATTGTTCCT No data
Right 1019177912 6:170169908-170169930 GGGATTGTTCCTGCCTGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177912 Original CRISPR GGGATTGTTCCTGCCTGTTC GGG Intergenic