ID: 1019177913

View in Genome Browser
Species Human (GRCh38)
Location 6:170169909-170169931
Sequence GGATTGTTCCTGCCTGTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019177906_1019177913 9 Left 1019177906 6:170169877-170169899 CCTGACTGTTCGGGATTGTTCCT No data
Right 1019177913 6:170169909-170169931 GGATTGTTCCTGCCTGTTCGGGG No data
1019177903_1019177913 29 Left 1019177903 6:170169857-170169879 CCTCTCTGTTTGGGGTTGTTCCT No data
Right 1019177913 6:170169909-170169931 GGATTGTTCCTGCCTGTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019177913 Original CRISPR GGATTGTTCCTGCCTGTTCG GGG Intergenic