ID: 1019180273

View in Genome Browser
Species Human (GRCh38)
Location 6:170182557-170182579
Sequence GAGAATCCACACCTGCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019180267_1019180273 30 Left 1019180267 6:170182504-170182526 CCATGCCTATACTTGCAGGCAGG No data
Right 1019180273 6:170182557-170182579 GAGAATCCACACCTGCAGGTGGG No data
1019180269_1019180273 25 Left 1019180269 6:170182509-170182531 CCTATACTTGCAGGCAGGAACAC No data
Right 1019180273 6:170182557-170182579 GAGAATCCACACCTGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019180273 Original CRISPR GAGAATCCACACCTGCAGGT GGG Intergenic
No off target data available for this crispr