ID: 1019183813

View in Genome Browser
Species Human (GRCh38)
Location 6:170209344-170209366
Sequence CTCTGTCCTGCCTGCCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019183813_1019183822 30 Left 1019183813 6:170209344-170209366 CCTGATGGGCAGGCAGGACAGAG No data
Right 1019183822 6:170209397-170209419 CATACAATTGGTAGCTAGAGGGG No data
1019183813_1019183818 18 Left 1019183813 6:170209344-170209366 CCTGATGGGCAGGCAGGACAGAG No data
Right 1019183818 6:170209385-170209407 CACAGGCACCTGCATACAATTGG No data
1019183813_1019183816 1 Left 1019183813 6:170209344-170209366 CCTGATGGGCAGGCAGGACAGAG No data
Right 1019183816 6:170209368-170209390 GAGCCTCATGAGCACTGCACAGG No data
1019183813_1019183821 29 Left 1019183813 6:170209344-170209366 CCTGATGGGCAGGCAGGACAGAG No data
Right 1019183821 6:170209396-170209418 GCATACAATTGGTAGCTAGAGGG No data
1019183813_1019183820 28 Left 1019183813 6:170209344-170209366 CCTGATGGGCAGGCAGGACAGAG No data
Right 1019183820 6:170209395-170209417 TGCATACAATTGGTAGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019183813 Original CRISPR CTCTGTCCTGCCTGCCCATC AGG (reversed) Intergenic
No off target data available for this crispr