ID: 1019183820

View in Genome Browser
Species Human (GRCh38)
Location 6:170209395-170209417
Sequence TGCATACAATTGGTAGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019183813_1019183820 28 Left 1019183813 6:170209344-170209366 CCTGATGGGCAGGCAGGACAGAG No data
Right 1019183820 6:170209395-170209417 TGCATACAATTGGTAGCTAGAGG No data
1019183817_1019183820 1 Left 1019183817 6:170209371-170209393 CCTCATGAGCACTGCACAGGCAC No data
Right 1019183820 6:170209395-170209417 TGCATACAATTGGTAGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019183820 Original CRISPR TGCATACAATTGGTAGCTAG AGG Intergenic
No off target data available for this crispr