ID: 1019190490

View in Genome Browser
Species Human (GRCh38)
Location 6:170247987-170248009
Sequence CTTGGTTTTCACCGGCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019190490_1019190497 14 Left 1019190490 6:170247987-170248009 CCCCAATGCCGGTGAAAACCAAG No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019190490 Original CRISPR CTTGGTTTTCACCGGCATTG GGG (reversed) Intergenic