ID: 1019190492 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:170247989-170248011 |
| Sequence | ATCTTGGTTTTCACCGGCAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019190492_1019190497 | 12 | Left | 1019190492 | 6:170247989-170248011 | CCAATGCCGGTGAAAACCAAGAT | No data | ||
| Right | 1019190497 | 6:170248024-170248046 | AGAGAAGAAAACTGAGATGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019190492 | Original CRISPR | ATCTTGGTTTTCACCGGCAT TGG (reversed) | Intergenic | ||