ID: 1019190494

View in Genome Browser
Species Human (GRCh38)
Location 6:170247995-170248017
Sequence ACCGGCATCTTGGTTTTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019190494_1019190497 6 Left 1019190494 6:170247995-170248017 CCGGTGAAAACCAAGATGCCGGT No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019190494 Original CRISPR ACCGGCATCTTGGTTTTCAC CGG (reversed) Intergenic
No off target data available for this crispr