ID: 1019190495

View in Genome Browser
Species Human (GRCh38)
Location 6:170248005-170248027
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019190495_1019190497 -4 Left 1019190495 6:170248005-170248027 CCAAGATGCCGGTATATGCAGAG No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data
1019190495_1019190499 26 Left 1019190495 6:170248005-170248027 CCAAGATGCCGGTATATGCAGAG No data
Right 1019190499 6:170248054-170248076 CGAGAAGAAAAACGAGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019190495 Original CRISPR CTCTGCATATACCGGCATCT TGG (reversed) Intergenic