ID: 1019190497

View in Genome Browser
Species Human (GRCh38)
Location 6:170248024-170248046
Sequence AGAGAAGAAAACTGAGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019190494_1019190497 6 Left 1019190494 6:170247995-170248017 CCGGTGAAAACCAAGATGCCGGT No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data
1019190492_1019190497 12 Left 1019190492 6:170247989-170248011 CCAATGCCGGTGAAAACCAAGAT No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data
1019190491_1019190497 13 Left 1019190491 6:170247988-170248010 CCCAATGCCGGTGAAAACCAAGA No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data
1019190490_1019190497 14 Left 1019190490 6:170247987-170248009 CCCCAATGCCGGTGAAAACCAAG No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data
1019190495_1019190497 -4 Left 1019190495 6:170248005-170248027 CCAAGATGCCGGTATATGCAGAG No data
Right 1019190497 6:170248024-170248046 AGAGAAGAAAACTGAGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019190497 Original CRISPR AGAGAAGAAAACTGAGATGA CGG Intergenic