ID: 1019190796

View in Genome Browser
Species Human (GRCh38)
Location 6:170249475-170249497
Sequence AATCCATCCTGTATCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019190796_1019190804 23 Left 1019190796 6:170249475-170249497 CCCACATAGATACAGGATGGATT No data
Right 1019190804 6:170249521-170249543 TTGTCGTGCTGAAGTGAGGTTGG No data
1019190796_1019190802 19 Left 1019190796 6:170249475-170249497 CCCACATAGATACAGGATGGATT No data
Right 1019190802 6:170249517-170249539 CCCTTTGTCGTGCTGAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019190796 Original CRISPR AATCCATCCTGTATCTATGT GGG (reversed) Intergenic
No off target data available for this crispr