ID: 1019195754

View in Genome Browser
Species Human (GRCh38)
Location 6:170281746-170281768
Sequence CTCCTCCGCTTCCCGTCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019195754_1019195763 18 Left 1019195754 6:170281746-170281768 CCCACCGACGGGAAGCGGAGGAG No data
Right 1019195763 6:170281787-170281809 CGCCCCGTCTGGGGCCATGTTGG No data
1019195754_1019195760 9 Left 1019195754 6:170281746-170281768 CCCACCGACGGGAAGCGGAGGAG No data
Right 1019195760 6:170281778-170281800 TGACTCCCACGCCCCGTCTGGGG No data
1019195754_1019195758 7 Left 1019195754 6:170281746-170281768 CCCACCGACGGGAAGCGGAGGAG No data
Right 1019195758 6:170281776-170281798 CGTGACTCCCACGCCCCGTCTGG No data
1019195754_1019195759 8 Left 1019195754 6:170281746-170281768 CCCACCGACGGGAAGCGGAGGAG No data
Right 1019195759 6:170281777-170281799 GTGACTCCCACGCCCCGTCTGGG No data
1019195754_1019195767 28 Left 1019195754 6:170281746-170281768 CCCACCGACGGGAAGCGGAGGAG No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019195754 Original CRISPR CTCCTCCGCTTCCCGTCGGT GGG (reversed) Intergenic
No off target data available for this crispr