ID: 1019195761

View in Genome Browser
Species Human (GRCh38)
Location 6:170281783-170281805
Sequence CATGGCCCCAGACGGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019195761_1019195770 23 Left 1019195761 6:170281783-170281805 CCCACGCCCCGTCTGGGGCCATG No data
Right 1019195770 6:170281829-170281851 CATGACAGCTGTGACCCACTGGG No data
1019195761_1019195769 22 Left 1019195761 6:170281783-170281805 CCCACGCCCCGTCTGGGGCCATG No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195761_1019195767 -9 Left 1019195761 6:170281783-170281805 CCCACGCCCCGTCTGGGGCCATG No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019195761 Original CRISPR CATGGCCCCAGACGGGGCGT GGG (reversed) Intergenic
No off target data available for this crispr