ID: 1019195762

View in Genome Browser
Species Human (GRCh38)
Location 6:170281784-170281806
Sequence ACATGGCCCCAGACGGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019195762_1019195767 -10 Left 1019195762 6:170281784-170281806 CCACGCCCCGTCTGGGGCCATGT No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data
1019195762_1019195770 22 Left 1019195762 6:170281784-170281806 CCACGCCCCGTCTGGGGCCATGT No data
Right 1019195770 6:170281829-170281851 CATGACAGCTGTGACCCACTGGG No data
1019195762_1019195769 21 Left 1019195762 6:170281784-170281806 CCACGCCCCGTCTGGGGCCATGT No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019195762 Original CRISPR ACATGGCCCCAGACGGGGCG TGG (reversed) Intergenic
No off target data available for this crispr