ID: 1019195764

View in Genome Browser
Species Human (GRCh38)
Location 6:170281789-170281811
Sequence CGCCAACATGGCCCCAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019195764_1019195769 16 Left 1019195764 6:170281789-170281811 CCCCGTCTGGGGCCATGTTGGCG No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195764_1019195770 17 Left 1019195764 6:170281789-170281811 CCCCGTCTGGGGCCATGTTGGCG No data
Right 1019195770 6:170281829-170281851 CATGACAGCTGTGACCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019195764 Original CRISPR CGCCAACATGGCCCCAGACG GGG (reversed) Intergenic
No off target data available for this crispr