ID: 1019195767

View in Genome Browser
Species Human (GRCh38)
Location 6:170281797-170281819
Sequence GGGGCCATGTTGGCGTCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019195755_1019195767 27 Left 1019195755 6:170281747-170281769 CCACCGACGGGAAGCGGAGGAGC No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data
1019195761_1019195767 -9 Left 1019195761 6:170281783-170281805 CCCACGCCCCGTCTGGGGCCATG No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data
1019195756_1019195767 24 Left 1019195756 6:170281750-170281772 CCGACGGGAAGCGGAGGAGCAGC No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data
1019195754_1019195767 28 Left 1019195754 6:170281746-170281768 CCCACCGACGGGAAGCGGAGGAG No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data
1019195757_1019195767 -1 Left 1019195757 6:170281775-170281797 CCGTGACTCCCACGCCCCGTCTG No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data
1019195762_1019195767 -10 Left 1019195762 6:170281784-170281806 CCACGCCCCGTCTGGGGCCATGT No data
Right 1019195767 6:170281797-170281819 GGGGCCATGTTGGCGTCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019195767 Original CRISPR GGGGCCATGTTGGCGTCAAA CGG Intergenic
No off target data available for this crispr