ID: 1019195768

View in Genome Browser
Species Human (GRCh38)
Location 6:170281801-170281823
Sequence GTCGCCGTTTGACGCCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019195768_1019195769 4 Left 1019195768 6:170281801-170281823 CCATGTTGGCGTCAAACGGCGAC No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195768_1019195770 5 Left 1019195768 6:170281801-170281823 CCATGTTGGCGTCAAACGGCGAC No data
Right 1019195770 6:170281829-170281851 CATGACAGCTGTGACCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019195768 Original CRISPR GTCGCCGTTTGACGCCAACA TGG (reversed) Intergenic
No off target data available for this crispr