ID: 1019195769

View in Genome Browser
Species Human (GRCh38)
Location 6:170281828-170281850
Sequence TCATGACAGCTGTGACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019195768_1019195769 4 Left 1019195768 6:170281801-170281823 CCATGTTGGCGTCAAACGGCGAC No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195761_1019195769 22 Left 1019195761 6:170281783-170281805 CCCACGCCCCGTCTGGGGCCATG No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195762_1019195769 21 Left 1019195762 6:170281784-170281806 CCACGCCCCGTCTGGGGCCATGT No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195764_1019195769 16 Left 1019195764 6:170281789-170281811 CCCCGTCTGGGGCCATGTTGGCG No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195757_1019195769 30 Left 1019195757 6:170281775-170281797 CCGTGACTCCCACGCCCCGTCTG No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195765_1019195769 15 Left 1019195765 6:170281790-170281812 CCCGTCTGGGGCCATGTTGGCGT No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data
1019195766_1019195769 14 Left 1019195766 6:170281791-170281813 CCGTCTGGGGCCATGTTGGCGTC No data
Right 1019195769 6:170281828-170281850 TCATGACAGCTGTGACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019195769 Original CRISPR TCATGACAGCTGTGACCCAC TGG Intergenic
No off target data available for this crispr