ID: 1019197398

View in Genome Browser
Species Human (GRCh38)
Location 6:170290482-170290504
Sequence GCTTCTTCGCAGGAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019197386_1019197398 21 Left 1019197386 6:170290438-170290460 CCCCCGAGGAGGTGAGGGTCGCC 0: 1
1: 0
2: 12
3: 220
4: 2775
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197392_1019197398 0 Left 1019197392 6:170290459-170290481 CCGGCTTCCTGGTTTTGTCTTGA 0: 1
1: 0
2: 1
3: 97
4: 350
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197381_1019197398 29 Left 1019197381 6:170290430-170290452 CCTCCCAGCCCCCGAGGAGGTGA 0: 1
1: 0
2: 2
3: 27
4: 243
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197390_1019197398 18 Left 1019197390 6:170290441-170290463 CCGAGGAGGTGAGGGTCGCCGGC 0: 1
1: 0
2: 0
3: 8
4: 184
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197388_1019197398 19 Left 1019197388 6:170290440-170290462 CCCGAGGAGGTGAGGGTCGCCGG 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197387_1019197398 20 Left 1019197387 6:170290439-170290461 CCCCGAGGAGGTGAGGGTCGCCG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197385_1019197398 25 Left 1019197385 6:170290434-170290456 CCAGCCCCCGAGGAGGTGAGGGT 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197393_1019197398 -7 Left 1019197393 6:170290466-170290488 CCTGGTTTTGTCTTGAGCTTCTT 0: 1
1: 0
2: 2
3: 24
4: 268
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174
1019197383_1019197398 26 Left 1019197383 6:170290433-170290455 CCCAGCCCCCGAGGAGGTGAGGG 0: 1
1: 0
2: 3
3: 21
4: 292
Right 1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019197398 Original CRISPR GCTTCTTCGCAGGAGAGGGA GGG Intergenic
901037479 1:6344992-6345014 GCTGCTTCCCAGGAGCGGGCAGG + Intronic
902354036 1:15882983-15883005 CCTTCTTCCCAGAAGAGAGAGGG + Intronic
902736680 1:18405822-18405844 GCTTTTTCGTAGGGGAGAGAGGG + Intergenic
903927360 1:26840123-26840145 GCCTCTCCCCAGGACAGGGAGGG - Intronic
905259317 1:36706360-36706382 ACTTCTTCCCAGGAGATGGCAGG + Intergenic
905281728 1:36853590-36853612 GCGTGGTCTCAGGAGAGGGAGGG - Intronic
905752351 1:40477223-40477245 GCTGCTTCCCGGGAGAGGGCGGG + Exonic
906019108 1:42611273-42611295 ATTTCTTCTCAAGAGAGGGAAGG + Intronic
907334124 1:53689348-53689370 GCTTCTTGCCAGGAGAAGGAGGG - Intronic
910434442 1:87190953-87190975 GCTTTTCTGCTGGAGAGGGAGGG + Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
915323488 1:155069000-155069022 GCTCCTTGGGATGAGAGGGAAGG - Exonic
915933871 1:160078591-160078613 GCTGCTTGGCAGGACAGAGAAGG + Intergenic
919823640 1:201488824-201488846 GCTGCTGGGCATGAGAGGGATGG - Intronic
919843828 1:201628612-201628634 GCAGCTTGGCAGGAGGGGGAGGG - Intronic
923753984 1:236773413-236773435 GCTTCTTCTTAGGGGAAGGAAGG - Intergenic
1062929626 10:1344373-1344395 GCTGCATGGCAGGAGAAGGAAGG + Intronic
1065276047 10:24086746-24086768 GTTTCTTATCAGGAGTGGGAGGG + Intronic
1068885474 10:62092599-62092621 GCCTCTGAGCAGGAGAGTGAAGG + Exonic
1070827174 10:79398071-79398093 GCTGCTTGGCAGGCAAGGGATGG + Intronic
1070835079 10:79442942-79442964 GCTTCCTCGGAGGTGATGGAGGG - Intronic
1070987025 10:80697908-80697930 GATTCCTAGCTGGAGAGGGAGGG - Intergenic
1072245815 10:93542933-93542955 GCAGATTTGCAGGAGAGGGAAGG + Intergenic
1074026756 10:109644000-109644022 GTTTGTTGGTAGGAGAGGGACGG - Intergenic
1078924077 11:15858531-15858553 GCTCCTTCCCATGGGAGGGATGG + Intergenic
1082161111 11:48888814-48888836 GTTTCTTCCCAGGAAAGGCAGGG + Intergenic
1084088954 11:66867825-66867847 GCTTCTCCTAAGGGGAGGGAGGG + Intronic
1089270752 11:117300039-117300061 CCTGCCTCGCAGGAGAGGAAGGG - Intronic
1089602222 11:119623208-119623230 GCTTCCCAGCAGGAGAGGAAGGG + Intergenic
1091186889 11:133655368-133655390 GCTTCTGCGTAGAAGAGTGAAGG - Intergenic
1092147629 12:6225523-6225545 GCTTCTACACAGGTGAGGGACGG + Exonic
1092852605 12:12644331-12644353 GCTCCTTCACTGGAAAGGGAAGG - Exonic
1093897631 12:24592818-24592840 TCTTCTTCTCAGGAGAGCCAAGG - Intergenic
1097697940 12:62792714-62792736 GCTTCTAGGGAGGAGGGGGAGGG - Intronic
1103928102 12:124434737-124434759 CCTTCCTCGCAGGAGACAGAGGG + Intronic
1104944478 12:132409524-132409546 GCTTCTGGGCGGGAGAGGTAGGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105604939 13:21919503-21919525 GCTTCTTCCCAAGGGAGGGCAGG + Intergenic
1108026623 13:46184709-46184731 GCTTCAGGGCAGGAGAGGGTGGG - Intronic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1112420785 13:99246712-99246734 GCTTACTCTCAGAAGAGGGAAGG + Intronic
1114557450 14:23570160-23570182 ACTTCTTCCCGGGAGAGGGAGGG + Intronic
1116892866 14:50285879-50285901 GCATCTTAGGAGGAGAGGAAAGG - Intronic
1120568195 14:86085522-86085544 GCTTCCAGGCACGAGAGGGAAGG + Intergenic
1121685020 14:95829445-95829467 ACTTCCTAGCAGGGGAGGGAGGG + Intergenic
1122737093 14:103848966-103848988 GCTTTTTCGGATGCGAGGGATGG + Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1125517452 15:40330370-40330392 GTACCTTCGCGGGAGAGGGAGGG - Intergenic
1127165688 15:56243525-56243547 GCTTCACCGCGGGAGAGGCATGG + Intergenic
1128392469 15:67191610-67191632 GCTTCACCTCAGGAGAGAGAAGG - Exonic
1129001962 15:72342680-72342702 GCATCTTCGCAGGGAATGGATGG - Exonic
1129230595 15:74195119-74195141 GCTGCTCTGCAGGAGAGGCAGGG - Intronic
1130512564 15:84601344-84601366 GCTTCTCGGTAGGAGAGGCAAGG - Intronic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135773418 16:25235064-25235086 CTTTCTTCCCAGGACAGGGAGGG - Intergenic
1137793685 16:51196685-51196707 GCTTCTTCTCGGCAGAAGGAGGG - Intergenic
1138148671 16:54635488-54635510 GCTACTTAGCAGCAGAGGCAAGG + Intergenic
1139717880 16:68828196-68828218 GTTTCTTCGGAGGAGAGCGGTGG + Exonic
1140813097 16:78597043-78597065 GCTTCTACGCAGAAGAGGGTAGG - Intronic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1142217163 16:88835483-88835505 GCCTCTTCCCAGAAGAGGAATGG + Intronic
1142667791 17:1472367-1472389 GCTTCCTCGCAGCAGAGGAGGGG + Intronic
1143164338 17:4890351-4890373 GCTTCTTTGCTGGAACGGGATGG + Intronic
1143475849 17:7203642-7203664 GCTTGGTCCCTGGAGAGGGAGGG - Intronic
1143562073 17:7702330-7702352 GCTTTTTTGCTAGAGAGGGAAGG - Exonic
1143632975 17:8149350-8149372 GATTCTTCGCAGCCTAGGGAAGG - Intronic
1145276399 17:21433923-21433945 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1145314234 17:21719816-21719838 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1145712687 17:26991795-26991817 TCTTCTTCTGAAGAGAGGGAAGG + Intergenic
1147551003 17:41441391-41441413 GTTTCTTCCCTGGATAGGGAAGG - Intergenic
1149684395 17:58527145-58527167 GCTTGTGAGCAGGTGAGGGAGGG - Intronic
1150359167 17:64515475-64515497 GCTTGCTCGCAGGAAGGGGAGGG + Intronic
1150446045 17:65227609-65227631 TCTTCTGCCCAGGGGAGGGAGGG - Exonic
1153930096 18:9870632-9870654 GCTTCTGGGCTGGAGAAGGAGGG - Intergenic
1156164063 18:34396773-34396795 TCCTCTTGGCAGAAGAGGGAGGG + Intergenic
1157091104 18:44638174-44638196 GCTACCTCGCAGGAGTGGGCAGG - Intergenic
1157609014 18:48944494-48944516 GCTTCTTCACAGGGGTGGTAGGG - Intronic
1160225059 18:77005974-77005996 GCTGTTTCACAGGAGAGGGAAGG + Intronic
1162904102 19:13813238-13813260 TCCTCTTCCCAGGAGAGAGAGGG + Intronic
1164770959 19:30808575-30808597 GGTTCATCCCAGGAAAGGGATGG + Intergenic
1166358139 19:42239527-42239549 ACTTCTTCCCAGGAGAGAAAGGG - Intronic
1166766518 19:45254455-45254477 GCTTCTTCCCAGGAGAGACCAGG - Intronic
1166920414 19:46225414-46225436 GCTTGTTCTGAGGAGAAGGAAGG - Intergenic
1167105415 19:47427551-47427573 GCATCTTGGCAGGAGAGAGGTGG - Intergenic
1167305194 19:48704081-48704103 GCATCTTCACAGAAGAGAGATGG - Exonic
925157270 2:1657697-1657719 GGTTCTTGTCAGGAGGGGGAAGG - Intronic
926672935 2:15592138-15592160 GATTCTTCCCAGGAGCGGGCCGG + Intronic
930219567 2:48732699-48732721 GCTTCCTCTCAGGAGAAGCAAGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935102750 2:100012232-100012254 ACTTCTTCAAAGGAGAGGAAAGG + Intronic
935520362 2:104096759-104096781 GCTTTTTGGCAGGGGTGGGAGGG - Intergenic
935940102 2:108229110-108229132 GCTTCTTCCCAGGAGGCTGATGG + Intergenic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
937460556 2:122082022-122082044 GCCTGTCTGCAGGAGAGGGAAGG - Intergenic
938240080 2:129736601-129736623 GTTTCTTCACTGTAGAGGGAGGG - Intergenic
938501934 2:131834949-131834971 GCTTCTGAGCAGGAGGGGGTCGG + Intergenic
940005744 2:149008100-149008122 GCTTCTTTCCAGGAGAGAGGAGG - Intronic
943235187 2:185308740-185308762 TCTTTTTCCCAGGAAAGGGAGGG + Intergenic
945267858 2:207908935-207908957 GCTTCTTCACAGCAGAATGAGGG + Intronic
947732589 2:232439495-232439517 ACTGCTCCCCAGGAGAGGGAGGG + Intergenic
948273119 2:236688868-236688890 GCTTCCTCCCATGGGAGGGAGGG - Intergenic
948550000 2:238764973-238764995 CCTTCTTAGCAGGAGTGAGAGGG + Intergenic
948725506 2:239931339-239931361 GTGTCATCGAAGGAGAGGGAGGG - Intronic
948766672 2:240225610-240225632 GCTTCTAGTCAGGAGAAGGAAGG + Intergenic
1169347209 20:4838265-4838287 GCATCTTTGGTGGAGAGGGACGG + Intergenic
1170569351 20:17624146-17624168 GCTCCTTTCCAAGAGAGGGATGG - Intronic
1171245562 20:23607432-23607454 GTTTCTTAGCTGGAGAGTGATGG + Intergenic
1173470432 20:43319445-43319467 GCTTCTCTGCAGGCCAGGGATGG + Intergenic
1173995876 20:47338334-47338356 GGTTCTGAGCAGGAAAGGGATGG - Intronic
1175608960 20:60334328-60334350 GCTTCTTCCCAGGAGCCGGCAGG + Intergenic
1175945576 20:62557046-62557068 GCTTGCACGCAGGAGAAGGACGG + Intronic
1176024055 20:62976950-62976972 GCTTCTGCACAGGAAGGGGAGGG + Intergenic
1180147772 21:45930797-45930819 GCTTCTTCGGAGGAGTGTAAAGG - Exonic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181548481 22:23620189-23620211 GCTGCTTGGGAGGTGAGGGAGGG - Intronic
1183031667 22:35111117-35111139 ACTTCTTCGAAGGGAAGGGAAGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
952155961 3:30643932-30643954 GCTTCTTCCCAGAAGGGGGCAGG + Intronic
954626578 3:52025153-52025175 GCTCCGGGGCAGGAGAGGGATGG + Intergenic
955004717 3:54957890-54957912 GGTTCTCAGCAGGGGAGGGAAGG - Intronic
955338827 3:58109167-58109189 GCTTTTTTGCAGGATGGGGAAGG + Exonic
955724620 3:61919831-61919853 GCTTCTTAGCTGCAGAGGTAAGG - Intronic
955844642 3:63149260-63149282 GCTTTTAAGCAGGAGAGTGACGG + Intergenic
956802415 3:72772275-72772297 TCTACTTGGCAGGAGAGGGAGGG + Intronic
959497514 3:107068676-107068698 GCTTCTTCGCAGCTCGGGGAAGG + Intergenic
960950869 3:122997666-122997688 GCATCTTTGCTGCAGAGGGAGGG - Intronic
961002111 3:123380859-123380881 GATACTTGCCAGGAGAGGGAGGG + Intronic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
964719961 3:159761585-159761607 GGTTCCTGGCAGGAGATGGAAGG + Intronic
965872821 3:173281025-173281047 GCTTATTAGCAGAAGAGGGTGGG + Intergenic
968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG + Exonic
968803503 4:2757693-2757715 GCTTCCTCTCAGCAGAAGGAAGG + Intergenic
969053956 4:4390265-4390287 GCTCCTGCGGTGGAGAGGGAGGG - Intronic
969074305 4:4565290-4565312 TATTCTTCCCAGGAGAGGGAAGG + Intergenic
973105012 4:46324717-46324739 GCTTATTTGATGGAGAGGGAGGG - Intronic
974272410 4:59667584-59667606 GCTACTTGGCAAGAGAGGGAAGG - Intergenic
978903133 4:113977277-113977299 TCTCATTCTCAGGAGAGGGAAGG + Intronic
981203297 4:142009435-142009457 GCTTCTACACAGGAAAGGAAAGG - Intergenic
986966228 5:13275174-13275196 ACTTCTTCTCTGGAGAGGGGAGG + Intergenic
987320931 5:16768785-16768807 GCTGCTTGGGAGGAGAGGGTGGG - Intronic
997127178 5:131239071-131239093 GCTTCTACCCAGGAGACAGACGG + Intergenic
997677640 5:135725086-135725108 GCTTCTGCCCAGGAAAGGTATGG - Intergenic
999207933 5:149863429-149863451 GCTTCTAAGCAGGTGAGGCATGG - Intronic
1000575287 5:162968759-162968781 ACATGTTGGCAGGAGAGGGAAGG - Intergenic
1000710232 5:164565715-164565737 GCTTCTTTCCAGGAGAGTGAGGG - Intergenic
1001315148 5:170636626-170636648 CCTGTTTCTCAGGAGAGGGATGG + Intronic
1001640747 5:173242549-173242571 GCTGACTCTCAGGAGAGGGAAGG - Intergenic
1003432935 6:6056607-6056629 GCTTCTTTGCAGCAGAGGTTGGG + Intergenic
1003457055 6:6292876-6292898 GTCTCTTCAGAGGAGAGGGATGG - Intronic
1003643837 6:7898365-7898387 GAGTCTTTGCAGGTGAGGGATGG + Intronic
1003645010 6:7907710-7907732 GGGTCTATGCAGGAGAGGGAAGG - Intronic
1003980097 6:11381249-11381271 GCTTCTGGGCAGGGGAAGGAGGG + Intronic
1004058887 6:12171160-12171182 GCTTTTTCTTGGGAGAGGGAGGG - Intergenic
1006298290 6:33179687-33179709 GCTGCTTCCCTGGAAAGGGAAGG - Intronic
1007390843 6:41548683-41548705 GCTGGTTCGCAGCAGGGGGAGGG - Intronic
1012097853 6:94987772-94987794 GATTTTTTGCAGGAGTGGGAAGG + Intergenic
1016516097 6:144894545-144894567 ACTTCCTCCCAGCAGAGGGAAGG + Intergenic
1018082715 6:160272165-160272187 GCTTCATAGCAGAAAAGGGAAGG + Intronic
1018755792 6:166848959-166848981 ACTTCTAAGCAGGAGAGTGATGG - Intronic
1018884731 6:167925213-167925235 GTTTCTGCGTAGGAGAGGAATGG + Intronic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1019782146 7:2947541-2947563 ACCTCTTTGCGGGAGAGGGAGGG - Intronic
1019830081 7:3319262-3319284 CCTTTTCCACAGGAGAGGGATGG + Intronic
1028561271 7:92179031-92179053 GCTCCTTCGCAGGACCGGTAGGG + Exonic
1029373991 7:100167068-100167090 GCGTCCTGGCAGGAGAGAGAGGG + Exonic
1031133682 7:117862212-117862234 GCTTCTTGGCAGGCCTGGGAGGG + Intronic
1032151524 7:129433982-129434004 GCTTAGTCTCAGGGGAGGGATGG - Intronic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1035421834 7:158736040-158736062 GCAGCTTCGCAGGAGGGAGAAGG + Intronic
1037878998 8:22563971-22563993 GCTTCTTCTAAAGAAAGGGAAGG - Exonic
1038163348 8:25061435-25061457 TCTTCTTCCCAGGAGTGGGGCGG - Intergenic
1039104335 8:33973932-33973954 GCTTCTTTGAAGAAGAAGGAAGG - Intergenic
1040592231 8:48804326-48804348 GGTCCTTCAGAGGAGAGGGAGGG + Intergenic
1040988973 8:53328593-53328615 GCTTATTCACAGGAAAAGGAAGG + Intergenic
1042312617 8:67393830-67393852 TCTCCCTCGCAGGAGAGGGAAGG + Intergenic
1044931132 8:97252707-97252729 TCTTCTAAGCAGGAGAAGGATGG - Intergenic
1047520757 8:125593855-125593877 GCCTGTTCCCAGGAAAGGGAGGG - Intergenic
1049429116 8:142551007-142551029 GCTTTATTGGAGGAGAGGGATGG + Intergenic
1051029630 9:12658603-12658625 GCTCCTTGGCAGAAGAGGGCGGG - Intergenic
1053174177 9:35910341-35910363 GCATCTTCTTAGGAGACGGAAGG + Intergenic
1058570742 9:106340239-106340261 TCTTCTTCGAAAGAAAGGGAGGG - Intergenic
1059901285 9:118928939-118928961 GCTGCTTTGCAGGAGAAAGAAGG + Intergenic
1060225487 9:121787451-121787473 GCATCTCCCCAGCAGAGGGATGG - Intergenic
1062493702 9:136821788-136821810 AGTTCTCCGCGGGAGAGGGAGGG + Intronic
1186478575 X:9878372-9878394 GCAGCTTAGCAGCAGAGGGAAGG + Intronic
1187115765 X:16348856-16348878 GCTTCTTTGCATCAGAAGGAAGG - Intergenic
1193554124 X:82932501-82932523 GCTTCTTGGAAGAAGGGGGAGGG + Intergenic
1198180878 X:134207799-134207821 GGTGCTGAGCAGGAGAGGGAGGG + Intergenic
1200148920 X:153942024-153942046 GCTCCTTCCCGGTAGAGGGATGG - Exonic
1200710615 Y:6481595-6481617 GCTTCCCAGCAGCAGAGGGAGGG + Intergenic
1201023318 Y:9680389-9680411 GCTTCCCAGCAGCAGAGGGAGGG - Intergenic