ID: 1019197956

View in Genome Browser
Species Human (GRCh38)
Location 6:170292988-170293010
Sequence GTCCAAAAAGGACACCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019197956_1019197961 5 Left 1019197956 6:170292988-170293010 CCATGATGGTGTCCTTTTTGGAC No data
Right 1019197961 6:170293016-170293038 AGGGACTTGCTGTCGCCACAGGG No data
1019197956_1019197962 8 Left 1019197956 6:170292988-170293010 CCATGATGGTGTCCTTTTTGGAC No data
Right 1019197962 6:170293019-170293041 GACTTGCTGTCGCCACAGGGAGG No data
1019197956_1019197964 10 Left 1019197956 6:170292988-170293010 CCATGATGGTGTCCTTTTTGGAC No data
Right 1019197964 6:170293021-170293043 CTTGCTGTCGCCACAGGGAGGGG No data
1019197956_1019197960 4 Left 1019197956 6:170292988-170293010 CCATGATGGTGTCCTTTTTGGAC No data
Right 1019197960 6:170293015-170293037 TAGGGACTTGCTGTCGCCACAGG No data
1019197956_1019197963 9 Left 1019197956 6:170292988-170293010 CCATGATGGTGTCCTTTTTGGAC No data
Right 1019197963 6:170293020-170293042 ACTTGCTGTCGCCACAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019197956 Original CRISPR GTCCAAAAAGGACACCATCA TGG (reversed) Intergenic
No off target data available for this crispr