ID: 1019198031

View in Genome Browser
Species Human (GRCh38)
Location 6:170293496-170293518
Sequence TCTCGATTACGGCGGCAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019198023_1019198031 22 Left 1019198023 6:170293451-170293473 CCCCCCTCAGTATCAAGTATTTG No data
Right 1019198031 6:170293496-170293518 TCTCGATTACGGCGGCAAAGCGG No data
1019198025_1019198031 20 Left 1019198025 6:170293453-170293475 CCCCTCAGTATCAAGTATTTGTT No data
Right 1019198031 6:170293496-170293518 TCTCGATTACGGCGGCAAAGCGG No data
1019198027_1019198031 18 Left 1019198027 6:170293455-170293477 CCTCAGTATCAAGTATTTGTTAA No data
Right 1019198031 6:170293496-170293518 TCTCGATTACGGCGGCAAAGCGG No data
1019198024_1019198031 21 Left 1019198024 6:170293452-170293474 CCCCCTCAGTATCAAGTATTTGT No data
Right 1019198031 6:170293496-170293518 TCTCGATTACGGCGGCAAAGCGG No data
1019198026_1019198031 19 Left 1019198026 6:170293454-170293476 CCCTCAGTATCAAGTATTTGTTA No data
Right 1019198031 6:170293496-170293518 TCTCGATTACGGCGGCAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019198031 Original CRISPR TCTCGATTACGGCGGCAAAG CGG Intergenic
No off target data available for this crispr