ID: 1019198298

View in Genome Browser
Species Human (GRCh38)
Location 6:170295304-170295326
Sequence TGCACAGATGTGTTCACACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019198289_1019198298 1 Left 1019198289 6:170295280-170295302 CCCAGCCACGCCCACCCAAGTGG No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198286_1019198298 7 Left 1019198286 6:170295274-170295296 CCCCTGCCCAGCCACGCCCACCC No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198294_1019198298 -9 Left 1019198294 6:170295290-170295312 CCCACCCAAGTGGGTGCACAGAT No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198287_1019198298 6 Left 1019198287 6:170295275-170295297 CCCTGCCCAGCCACGCCCACCCA No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198293_1019198298 -4 Left 1019198293 6:170295285-170295307 CCACGCCCACCCAAGTGGGTGCA No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198288_1019198298 5 Left 1019198288 6:170295276-170295298 CCTGCCCAGCCACGCCCACCCAA No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198295_1019198298 -10 Left 1019198295 6:170295291-170295313 CCACCCAAGTGGGTGCACAGATG No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198291_1019198298 0 Left 1019198291 6:170295281-170295303 CCAGCCACGCCCACCCAAGTGGG No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201
1019198285_1019198298 13 Left 1019198285 6:170295268-170295290 CCATGTCCCCTGCCCAGCCACGC No data
Right 1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG 0: 1
1: 0
2: 0
3: 22
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019198298 Original CRISPR TGCACAGATGTGTTCACACT CGG Intronic
900081850 1:864388-864410 AGCGGAGATGTGTTCACAGTTGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
902818944 1:18931895-18931917 TGCACAGATGTGTACACATGGGG + Intronic
908323380 1:62999929-62999951 GGCACAGGTATGTACACACTTGG + Intergenic
908885772 1:68786645-68786667 TCCACAGATATGTTTAGACTTGG - Intergenic
910393866 1:86772380-86772402 TTCACAGTAGTGTTCACAGTAGG - Intergenic
910964534 1:92794828-92794850 TTCACAGAGCTGTTCACACATGG - Intergenic
911244745 1:95504408-95504430 AGCACAGATGTTTTCAGTCTCGG - Intergenic
911254536 1:95618984-95619006 TGCAAAGATTTGATCACACGGGG - Intergenic
911444449 1:97972539-97972561 TGCAAAGATGTGTGCATACAGGG + Intergenic
912138854 1:106696673-106696695 TGCACAGATGTTTTTAAACCTGG - Intergenic
912693066 1:111819123-111819145 TGCACACTTGTGGTCACACATGG - Intronic
915863063 1:159468201-159468223 TGCAATGAAATGTTCACACTGGG + Intergenic
917740541 1:177958178-177958200 TGCGCAGGTGTCTCCACACTGGG + Exonic
920413504 1:205781450-205781472 TGCACAGATGCGCTTACACAGGG - Intergenic
923011281 1:230089842-230089864 TGCACACCTGTGTTCACAGTAGG - Intronic
924464136 1:244284939-244284961 TGCACAGACGAGTTCCCACGGGG + Intergenic
1063193646 10:3719822-3719844 GGCTCAGGTCTGTTCACACTGGG - Intergenic
1063314142 10:4984953-4984975 TGCACAGAAGAGTTCACAAAGGG + Intronic
1063591334 10:7398656-7398678 AGCAGAGATGTAGTCACACTGGG + Intronic
1063948494 10:11200621-11200643 TGCAGAGATCTGTGCCCACTGGG - Intronic
1067273878 10:44817911-44817933 AGCACAGAGGTGAGCACACTAGG + Intergenic
1070493694 10:77001276-77001298 AGCACACAGGAGTTCACACTGGG + Intronic
1071135871 10:82453698-82453720 TGTACAGATAAGTTCAAACTAGG - Intronic
1071363984 10:84880046-84880068 TGCTCAGATGTTTTCAAATTTGG - Intergenic
1072573782 10:96681174-96681196 GACACAGATGTGTGCACACACGG - Intronic
1075292642 10:121243349-121243371 TGCACTGACCTGTTCCCACTGGG + Intergenic
1076842785 10:133054553-133054575 TGCACAGATGTGGTCACTCATGG + Intergenic
1077708215 11:4509222-4509244 TGCTCAGATGTGTTCAGGCATGG - Intergenic
1078016137 11:7616778-7616800 AGCAGAGATGGGTGCACACTGGG - Intronic
1078698949 11:13662307-13662329 TGCCCAGAAGTGTTCCTACTAGG - Intergenic
1079040648 11:17056368-17056390 AGCACAAAGGTGTTCACACATGG + Intergenic
1080857083 11:36121641-36121663 TGCACAGAAGTGTTCAGGCAGGG + Intronic
1086000603 11:81979923-81979945 TGCAAACATGTTTTCACACTTGG + Intergenic
1086878162 11:92122685-92122707 TACACAGCTGTATTCACACCTGG + Intergenic
1087329572 11:96763329-96763351 AACACTGATGGGTTCACACTTGG - Intergenic
1091758193 12:3069537-3069559 TGCACACACGTGCTCACACGTGG - Intergenic
1094284082 12:28772785-28772807 TGCTCAGATGTGAGCACTCTCGG - Intergenic
1095557417 12:43523677-43523699 TGCACAGAAGTATTCACCCAGGG - Intronic
1095615826 12:44187108-44187130 TGCACAGATGGACTCTCACTAGG + Intronic
1096245138 12:49980556-49980578 AGCACTGAAGTGATCACACTGGG + Intronic
1096549809 12:52364603-52364625 TGCACAGATGATTTTAGACTTGG - Intronic
1097926233 12:65130989-65131011 TTCTCAGATAAGTTCACACTAGG - Intergenic
1098736842 12:74115788-74115810 TGCACAGCATTGTTCACAATGGG + Intergenic
1100442168 12:94627294-94627316 TGCACAGCTGTCAGCACACTAGG + Intronic
1100788013 12:98099457-98099479 TGAACAGATCAGTGCACACTTGG + Intergenic
1104170001 12:126271255-126271277 TGCACAGATGTTTTCAAAATTGG - Intergenic
1105575513 13:21647530-21647552 TGGACACAGGTGTTCACACCAGG - Intergenic
1106033090 13:26020035-26020057 GACAAAGATGTGTTAACACTGGG - Exonic
1107585530 13:41843698-41843720 TGCAGAGAGGTGTTCATAGTAGG - Intronic
1109622267 13:64925633-64925655 AGCCCAGGTGTGTGCACACTTGG - Intergenic
1112133870 13:96553646-96553668 TGCACAGATGTGCCCACATTTGG + Intronic
1112558003 13:100486728-100486750 TGCAGAGATGAGGTCTCACTAGG - Intronic
1112844295 13:103618875-103618897 TGCTCATATGTGTTCATACAAGG + Intergenic
1113991545 14:16031188-16031210 TTAACAGATGTGTTGTCACTTGG - Intergenic
1114128028 14:19753706-19753728 TGCACAGATGTGAACAGAGTGGG - Intronic
1114786714 14:25608562-25608584 TGCACAGATATGTTTGTACTAGG + Intergenic
1115392050 14:32865092-32865114 TGCATAGAAGTGTTCATAATAGG + Intergenic
1117950204 14:61075266-61075288 TGCACAATTCTGTTCACACAAGG - Intronic
1120019890 14:79516466-79516488 TGCACAGATGTGTTTTCATCTGG + Intronic
1120239403 14:81932610-81932632 AGCACAGTGGTGTTCACACTGGG - Intergenic
1120859288 14:89240390-89240412 TGCACACATGTCTTCACTATTGG - Intronic
1122890170 14:104728584-104728606 GTCACAGGTGTGTGCACACTGGG + Intronic
1122945268 14:105005779-105005801 TGCTCAGCCGTGCTCACACTGGG - Intronic
1123062127 14:105599187-105599209 GGCACAGCTGTGCACACACTAGG - Intergenic
1123086874 14:105720915-105720937 GGCACAGCTGTGCACACACTAGG - Intergenic
1127633459 15:60847928-60847950 TGGAGAGTTGTGTTCTCACTGGG - Intronic
1127896503 15:63304331-63304353 TACACAGGTGTGTTCATGCTGGG + Intronic
1128481743 15:68045815-68045837 TGGCCAGGTGTGTGCACACTTGG + Intergenic
1129717005 15:77858336-77858358 GGCACAGAAGCGTTCACCCTGGG + Intergenic
1131106393 15:89737619-89737641 GGCACAGATGATTTCACGCTTGG - Exonic
1131310819 15:91288201-91288223 TGTACAGGTGTGTTCTCACCAGG + Intronic
1136536586 16:30903168-30903190 TGTACACATGTGCTCACACAGGG - Exonic
1137685418 16:50383415-50383437 TGAACATAGGGGTTCACACTTGG - Intergenic
1137846711 16:51696950-51696972 TGTGCACATGTGTGCACACTAGG - Intergenic
1138765664 16:59599832-59599854 TTCACAGATGTCTTCAGTCTAGG + Intergenic
1142189323 16:88710417-88710439 TTCTCAGATGTGTTCACAACAGG + Intronic
1145981516 17:29015102-29015124 TGCAAAAATGTGGTCAGACTTGG - Intronic
1147766932 17:42843288-42843310 TGCTCATATGTGTGCACGCTTGG + Exonic
1149275293 17:55027100-55027122 TGCACAGAAGAGTTCACACAGGG - Intronic
1149450863 17:56748964-56748986 TGCACAGATGGGTCCCCAGTCGG + Intergenic
1152902453 17:82950865-82950887 TGCACAGATGTGCTGCCACCTGG + Intronic
1155017689 18:21861798-21861820 TGCACAGATGTGTCTACTTTTGG + Intronic
1156145909 18:34177578-34177600 AGCACAGGTGTGTTCAGGCTAGG + Intronic
1160113405 18:76055150-76055172 TACACACATGTGTACATACTTGG - Intergenic
1162528103 19:11218628-11218650 TGCAGAGACGTGGTCTCACTAGG + Intronic
1163724220 19:18913420-18913442 GGCACAGATGTCACCACACTGGG - Intronic
1165454982 19:35905298-35905320 CACACAGCAGTGTTCACACTTGG + Intronic
1168598830 19:57701722-57701744 AGCACAGGAGGGTTCACACTGGG - Exonic
925803649 2:7627241-7627263 TGCTCAGTTGTGCTCACACAGGG - Intergenic
927108223 2:19845532-19845554 GGCACAGATGTGGTCACACATGG + Intergenic
927948753 2:27153301-27153323 AGCCCAGATCTGTTTACACTTGG - Exonic
929928767 2:46236077-46236099 AGCTCAGAGGTGTTCACCCTGGG - Intergenic
930035040 2:47080019-47080041 TGCTCAGCTGTGTGCACCCTTGG - Intronic
930066345 2:47330715-47330737 TGTAGAGATGTGGTCTCACTAGG + Intergenic
932535218 2:72585656-72585678 TGCATAGTGGTGTTCATACTAGG - Intronic
933349552 2:81136558-81136580 TGCACAGAAGTGTTTGCACAGGG - Intergenic
933626412 2:84605551-84605573 TCCAAAGATGTGTTTATACTGGG + Exonic
936832491 2:116664890-116664912 TGTATAGATGTGTTCACATTGGG + Intergenic
938077553 2:128347768-128347790 TGCACATGTGTGTGCACATTTGG - Intergenic
940790480 2:158025731-158025753 TACACAGATGTGTACACATATGG - Intronic
942401332 2:175606785-175606807 TCCACAGATTTATTCACATTAGG - Intergenic
945447891 2:209959731-209959753 GGCCAAGCTGTGTTCACACTTGG - Intronic
945646200 2:212498141-212498163 TGCACAGCCGTGTACACAATGGG + Intronic
946605321 2:221398353-221398375 TGCACAGATATGTAAACACATGG + Intergenic
947532525 2:230921753-230921775 TGCACAGCTCTGATCACCCTAGG + Intronic
947744961 2:232502770-232502792 TGCACACACGTGTGCACACGGGG - Intergenic
947811252 2:233005274-233005296 TCCGCAGATGTGTTCCCACATGG + Intronic
949059827 2:241950276-241950298 TGCACACCTGTGCTCACACACGG - Intergenic
949059831 2:241950304-241950326 TGCACACCTGTGCTCACACATGG - Intergenic
1168941104 20:1712069-1712091 TGCACAGAAGGGTTCGCACATGG - Intergenic
1170244371 20:14204494-14204516 TTCAGAGAGGAGTTCACACTGGG - Intronic
1170906060 20:20516080-20516102 TGCACAGAAGAGTTCACAATGGG - Intronic
1171958598 20:31477461-31477483 AACACATATGTGTTCTCACTCGG - Intronic
1173153502 20:40587839-40587861 TGCAGAGAAGTGTTTCCACTGGG - Intergenic
1175466866 20:59195255-59195277 TGCTCACAGGTGTTCTCACTTGG + Intronic
1175826415 20:61938743-61938765 GGCACAGATGTGTGCACTCAAGG - Exonic
1177873007 21:26596136-26596158 TGCACAGATGGGTGCACAGATGG + Intergenic
1179222869 21:39425236-39425258 ATCTCAGATGTGTCCACACTTGG - Intronic
1179296054 21:40063940-40063962 TGCACAGATGGGTTCAGCCTGGG + Intronic
1179936387 21:44607705-44607727 TGCACACATTTGCTGACACTCGG - Intronic
1180315725 22:11276335-11276357 TTAACAGATGTGTTGTCACTTGG + Intergenic
1181633583 22:24164050-24164072 TGCAGGGAGGTGTACACACTGGG + Intronic
1183719861 22:39556559-39556581 TGCCCAGATGTTGTCACACTGGG - Intergenic
1184876118 22:47276831-47276853 AGCAGAGGTGTGTTCACACCTGG + Intergenic
949646655 3:6103001-6103023 TGTACAAATGTATTCACAGTGGG - Intergenic
950478704 3:13231291-13231313 TGCACACATGTGTGCACACGTGG - Intergenic
951497245 3:23343647-23343669 TACACAGATGTGTTCACTTGAGG - Intronic
953075686 3:39568269-39568291 TGCATAGATGAGTTCACATCTGG + Intergenic
955100240 3:55841935-55841957 AGCACAGGTGTGTTCAGGCTAGG - Intronic
956424181 3:69115885-69115907 AGCTATGATGTGTTCACACTTGG - Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
958171730 3:89947550-89947572 TGCACAGAAGAGGTCACACAGGG - Intergenic
959897020 3:111617030-111617052 TGGCCAGGTGTGTGCACACTTGG + Intronic
961005844 3:123404825-123404847 TGCCCAGATGTGTCCACATTTGG - Intronic
962621630 3:137185988-137186010 TTCCCAGAAGTGTTCACCCTGGG - Intergenic
968632552 4:1659522-1659544 TGCATAGAGGTGGTCACATTTGG - Intronic
970428118 4:15963901-15963923 TGCAAATATATGTTCACAGTGGG + Intronic
970943662 4:21664802-21664824 TGCACAAAAGTCTTCACAGTAGG - Intronic
971044450 4:22790020-22790042 TGCACAGACGTGTTGAGATTTGG + Intergenic
976185107 4:82435420-82435442 TGCAGAGATGGGGTCTCACTGGG + Intronic
977562020 4:98542216-98542238 TGAGCAGATGTGTTGGCACTAGG - Intronic
977983671 4:103357094-103357116 GGCAGGGATGTGTTCATACTAGG - Intergenic
979368595 4:119855724-119855746 TTCACAGTTTTGTTCATACTTGG - Intergenic
982591070 4:157311603-157311625 TGAAGAGATATGTTCACATTAGG + Intronic
982667158 4:158279037-158279059 TGAACAGATGTGTAAACTCTAGG - Intergenic
983661646 4:170135336-170135358 TGCACAGAAGAGTTCACAAAGGG + Intergenic
983897332 4:173095633-173095655 TCTCCAAATGTGTTCACACTGGG + Intergenic
985054614 4:186025565-186025587 CGCACAGATGGTTTCACCCTTGG + Intergenic
985394871 4:189531388-189531410 TTCACAGAAGGGTTCACACAGGG + Intergenic
988099577 5:26659727-26659749 GGCACAGAGGAGTTCACAGTAGG - Intergenic
988493949 5:31728636-31728658 TGCACAGATTTGTTTACCCACGG + Intronic
989054187 5:37350865-37350887 TGCAAATATGTGTTTTCACTTGG - Intronic
989780173 5:45255306-45255328 TCCAGAAATGTCTTCACACTTGG + Intergenic
990103539 5:52224783-52224805 GGCACAGATGTGATGAAACTGGG - Intergenic
990757983 5:59096907-59096929 TACACACTTGTGTCCACACTTGG - Intronic
993456082 5:88129291-88129313 TTCACAGATGTAATCAGACTAGG + Intergenic
993655602 5:90574870-90574892 TGCATAGAGTTGTTCATACTAGG + Intronic
994390407 5:99185862-99185884 TGCACTGAGGAGTTCTCACTAGG - Intergenic
994943596 5:106356878-106356900 CTCTCAGATGTGTCCACACTGGG + Intergenic
995030808 5:107479126-107479148 TGTAGAGATTTGTTCACACTTGG + Intronic
996156283 5:120106699-120106721 TACACACATGTGTTTACAATCGG - Intergenic
996409060 5:123137172-123137194 TGCACATATGTGTGGACAGTGGG + Intronic
997643849 5:135467306-135467328 TGCACTGATATGTTCACAAGCGG - Intergenic
1000156116 5:158553470-158553492 TGCACAGATTTCTTCATATTTGG - Intergenic
1000232735 5:159331052-159331074 TGCACGCGTGTGTTCCCACTCGG - Intergenic
1001247447 5:170115360-170115382 CACACAGATGTGTTCACTTTAGG + Intergenic
1001420112 5:171579657-171579679 TGCACATCTGGGTTCATACTGGG + Intergenic
1001650622 5:173313384-173313406 TTAACCCATGTGTTCACACTTGG + Intergenic
1002680568 5:180959761-180959783 TGCACAGAAGAGTTTACACAGGG + Intergenic
1003052290 6:2790852-2790874 TTCAGAGATCTGTGCACACTGGG - Intergenic
1004026828 6:11827265-11827287 TCCAAAGATGGGTTCACACTGGG - Intergenic
1004172359 6:13305480-13305502 TTCACAGAGCTGTTCACAGTAGG + Intronic
1004522214 6:16372729-16372751 TGTAGAGATGAGTTCTCACTGGG - Intronic
1006101063 6:31686721-31686743 TGCACAGTTGTGATAACAGTAGG + Intergenic
1007053315 6:38855893-38855915 TGCACAGTTCAGTTCACAATAGG - Intronic
1008152436 6:47970715-47970737 TTAACAGATGTATTCCCACTAGG + Intronic
1010252839 6:73726090-73726112 TTCACAGGTATGTTCTCACTGGG - Intronic
1011197617 6:84798319-84798341 TCCACAGATGTGTCCACAGAAGG - Intergenic
1012696462 6:102390856-102390878 TGCACAGAAGAGTTCACAAAGGG - Intergenic
1013177592 6:107690679-107690701 TGCACAGAGATGTTCTCACTGGG + Intergenic
1015143235 6:129958600-129958622 TGGTCGGATGTGTGCACACTGGG + Intergenic
1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG + Intronic
1022779408 7:33563246-33563268 TGCATAGATGTCTTAAAACTGGG - Intronic
1023149171 7:37183612-37183634 AGCACAGATGTGCTCACAGCAGG + Intronic
1024762609 7:52618392-52618414 TGCAGGAATGTGTTCAGACTAGG - Intergenic
1024783707 7:52881436-52881458 TGCAGAGAAGTGTTAACACAGGG - Intergenic
1025973123 7:66346807-66346829 TGCATAGAAGTTTTTACACTTGG + Intronic
1027363375 7:77432172-77432194 CACACAGATGTATTCACATTGGG + Intergenic
1032409056 7:131680328-131680350 TGCCCAGATGTTTTCACATCTGG + Intergenic
1034746221 7:153526148-153526170 TGCACAGATATATGCACATTTGG + Intergenic
1035523423 8:293165-293187 AGCGGAGATGTGTTCACAGTTGG - Intergenic
1036333269 8:7848531-7848553 TGCACAAATGTGCACACACACGG + Intronic
1036552474 8:9827332-9827354 TGTAGAGATGGGTTCTCACTAGG - Intergenic
1039569027 8:38572120-38572142 GGCAAAGATGTGGTCCCACTGGG + Intergenic
1040802646 8:51360247-51360269 TGCATAGATGTGTACACATATGG - Intronic
1041881333 8:62753523-62753545 TGAACAAATGTGTTCACATAAGG + Intronic
1042320363 8:67469066-67469088 CGCACACATGTATTCACACTTGG - Intronic
1042354614 8:67812885-67812907 TTCCAAGATGTGTTCTCACTAGG - Intergenic
1044573510 8:93744947-93744969 GGCATAGCTGTATTCACACTTGG - Intergenic
1048360892 8:133696427-133696449 TGCACTCATGTGTGCACACAGGG - Intergenic
1049396742 8:142404444-142404466 GGCACAAATGTGTGCACACATGG + Intergenic
1049525593 8:143125217-143125239 TGCACACACGTGTACACACATGG + Intergenic
1050389229 9:5120663-5120685 AGCACAGAGGTCTTCACACAAGG - Intronic
1050462963 9:5892828-5892850 TGAACAGATGTTTTTCCACTTGG - Intronic
1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG + Intronic
1051500711 9:17774325-17774347 TGAATAGATGTGGTCACAGTGGG + Intronic
1052894071 9:33731200-33731222 AGCATAGATGTGTTCTCAGTGGG - Intergenic
1053476994 9:38389576-38389598 TCCAGGGATGTGTTTACACTGGG - Intergenic
1059378961 9:113908684-113908706 TGCACAGCGGTCTTCAAACTGGG - Intronic
1059576140 9:115490805-115490827 TGTACAGAAGTGTTCACATTGGG - Intergenic
1185742987 X:2548786-2548808 ATAACAGATGTGTTCAAACTGGG - Intergenic
1186056148 X:5651721-5651743 TGCAGAGATGGGGTCTCACTAGG - Intergenic
1186133081 X:6490721-6490743 TGCAAAGAGGTGTTCTCACCAGG - Intergenic
1186615555 X:11183347-11183369 TGCACAGAATTGTTCACAATAGG - Intronic
1189204257 X:39224295-39224317 TGCAAAGAAGTGTTCATAGTGGG + Intergenic
1193057443 X:77168574-77168596 TGCACAGAAAAGTTCACACAGGG + Intergenic
1196599510 X:117585489-117585511 TGCACAGAAGAGTTCACAGTGGG + Intergenic
1197767165 X:130066806-130066828 CTCCCAGATGTGGTCACACTAGG + Exonic
1198874524 X:141208981-141209003 AGGACACATGTGATCACACTAGG - Intergenic
1199069994 X:143464706-143464728 TGGAGAGATGGGTTTACACTGGG - Intergenic
1199412046 X:147535572-147535594 TGTAACAATGTGTTCACACTAGG + Intergenic
1199932516 X:152538107-152538129 TGCTCAGATTACTTCACACTAGG - Intergenic
1199966943 X:152828442-152828464 TTCAAAGAGGTGCTCACACTAGG + Intronic