ID: 1019198462

View in Genome Browser
Species Human (GRCh38)
Location 6:170295982-170296004
Sequence AAGGAGCCGCGGCGCAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019198462_1019198473 7 Left 1019198462 6:170295982-170296004 CCTCCTCTGCGCCGCGGCTCCTT 0: 1
1: 0
2: 1
3: 6
4: 212
Right 1019198473 6:170296012-170296034 AACCCGCGGATCATCTGCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 23
1019198462_1019198466 -7 Left 1019198462 6:170295982-170296004 CCTCCTCTGCGCCGCGGCTCCTT 0: 1
1: 0
2: 1
3: 6
4: 212
Right 1019198466 6:170295998-170296020 GCTCCTTCCCCTGGAACCCGCGG No data
1019198462_1019198472 6 Left 1019198462 6:170295982-170296004 CCTCCTCTGCGCCGCGGCTCCTT 0: 1
1: 0
2: 1
3: 6
4: 212
Right 1019198472 6:170296011-170296033 GAACCCGCGGATCATCTGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 29
1019198462_1019198471 5 Left 1019198462 6:170295982-170296004 CCTCCTCTGCGCCGCGGCTCCTT 0: 1
1: 0
2: 1
3: 6
4: 212
Right 1019198471 6:170296010-170296032 GGAACCCGCGGATCATCTGCTGG 0: 1
1: 0
2: 1
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019198462 Original CRISPR AAGGAGCCGCGGCGCAGAGG AGG (reversed) Intronic