ID: 1019198681

View in Genome Browser
Species Human (GRCh38)
Location 6:170296742-170296764
Sequence GCAGGAGCCCGCGCGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 369}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019198668_1019198681 4 Left 1019198668 6:170296715-170296737 CCCCGGATCCCGACGCCAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198665_1019198681 13 Left 1019198665 6:170296706-170296728 CCGCCGAGACCCCGGATCCCGAC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198661_1019198681 29 Left 1019198661 6:170296690-170296712 CCCAGAGGAGCGCGGCCCGCCGA 0: 1
1: 0
2: 1
3: 3
4: 52
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198662_1019198681 28 Left 1019198662 6:170296691-170296713 CCAGAGGAGCGCGGCCCGCCGAG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198672_1019198681 -4 Left 1019198672 6:170296723-170296745 CCCGACGCCAGGAGGTGCTGCAG 0: 1
1: 0
2: 2
3: 28
4: 259
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198673_1019198681 -5 Left 1019198673 6:170296724-170296746 CCGACGCCAGGAGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 32
4: 268
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198670_1019198681 3 Left 1019198670 6:170296716-170296738 CCCGGATCCCGACGCCAGGAGGT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198666_1019198681 10 Left 1019198666 6:170296709-170296731 CCGAGACCCCGGATCCCGACGCC 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198664_1019198681 14 Left 1019198664 6:170296705-170296727 CCCGCCGAGACCCCGGATCCCGA 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369
1019198671_1019198681 2 Left 1019198671 6:170296717-170296739 CCGGATCCCGACGCCAGGAGGTG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG 0: 1
1: 1
2: 2
3: 29
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019198681 Original CRISPR GCAGGAGCCCGCGCGGGGTG GGG Intronic
900104237 1:975506-975528 GCAGCAGCCCCTGCAGGGTGGGG - Exonic
900191909 1:1355643-1355665 GCCAGAGCCCGCGCATGGTGTGG - Exonic
900402463 1:2478164-2478186 GCAGGTGGCCGAGCAGGGTGGGG + Intronic
900626694 1:3611688-3611710 GCAGGAGCCGGGCTGGGGTGAGG - Intergenic
901242866 1:7704954-7704976 GCGGGGGCGCGCGCGGGGCGGGG + Intronic
901496598 1:9625977-9625999 GTGGGAGCCCGAGTGGGGTGAGG + Intergenic
902680735 1:18042186-18042208 GCAGGGGCCCCCGCGGGGGTGGG + Intergenic
902725071 1:18330086-18330108 GCAGGGACCCGAGGGGGGTGAGG - Intronic
902754097 1:18537718-18537740 GCAGGAGCCCGGCTGGAGTGGGG - Intergenic
903132760 1:21290295-21290317 GGAGCGGCCCGCGCGGGGAGGGG + Intronic
903172464 1:21562778-21562800 GCAGGAGCCAGCAAGGGGTTGGG - Intronic
903661517 1:24981580-24981602 GCAGGGGGCAGGGCGGGGTGGGG - Intergenic
904618935 1:31764087-31764109 GCAGGAGCCCGCGCCCGGCCCGG - Intronic
904852403 1:33468789-33468811 GCAGTAGCCCTTGGGGGGTGGGG - Intergenic
905448872 1:38044945-38044967 TCAGGAGTCCACGCGGGGAGAGG + Exonic
905793525 1:40802626-40802648 GAAGGAGCCCGGGCGGGGGAAGG + Intronic
905897435 1:41557889-41557911 TGAGGAGCCCTCGCTGGGTGGGG - Intronic
906797600 1:48710425-48710447 GCAGGAGCCAGAGCGTGGGGTGG + Intronic
907884174 1:58577491-58577513 GCAGGAGGCCGCGCCGAGGGCGG - Exonic
909340743 1:74528278-74528300 GCTGGAGCCTGAGCAGGGTGAGG + Intronic
910876793 1:91885830-91885852 GCTGCAGCCCGCCCGGGCTGTGG - Intronic
911527396 1:99004205-99004227 GCTGAAGCCACCGCGGGGTGTGG + Intronic
912385482 1:109269234-109269256 GCAGTAGCCCGGCCAGGGTGCGG - Exonic
914490908 1:148149613-148149635 GTGGGGGCCGGCGCGGGGTGAGG - Intronic
914869158 1:151458944-151458966 GCAGGGGCGGCCGCGGGGTGCGG - Intronic
914928099 1:151906416-151906438 GCAGGAGCCCACGGAGGGCGTGG - Intronic
920522142 1:206635673-206635695 TCGGGACCCCGCGCGGGGAGAGG - Exonic
920878421 1:209858730-209858752 GCAGGAGCCCACGGCGGGGGTGG + Intergenic
920965456 1:210697381-210697403 GCAGGAGGCAGCACGGGGTCTGG - Intronic
921390561 1:214609157-214609179 GCAGGAGGCCGGCCGGGGCGCGG - Intronic
921726739 1:218532848-218532870 GCAGGAGCCAGGGCCGGGCGCGG - Intergenic
924289513 1:242523998-242524020 GCATGAGCGCGCGCGGGGCGCGG - Intronic
1064207764 10:13338558-13338580 GCAGGAGTCTGGGCAGGGTGGGG + Intronic
1064461062 10:15535216-15535238 ACAGGAGCCCACGGAGGGTGGGG - Intronic
1064553038 10:16521367-16521389 GAAGGAGCTCGCGGGGGGCGAGG - Exonic
1067091159 10:43266517-43266539 GCAGGAGCGCACGCGGCGGGCGG - Intronic
1067759083 10:49029817-49029839 GCAGGAGCCCTGGCTTGGTGTGG + Intronic
1067937275 10:50623300-50623322 GCAGTAGCCCGCCCGGGGTCCGG - Intronic
1070609393 10:77923059-77923081 TCAGGAGCCCACACAGGGTGTGG + Intronic
1070766017 10:79056847-79056869 GCAGGAGCAGGCGCTGGGTCTGG - Intergenic
1074188616 10:111116995-111117017 GCAGGAGCCCCGGCTGGCTGGGG + Intergenic
1074317194 10:112370604-112370626 ACAGGAGCCCACGGAGGGTGGGG - Intergenic
1076250249 10:128979318-128979340 GCAGGAGCCCACATGGAGTGTGG - Intergenic
1076613223 10:131739047-131739069 GCAGGAGCGCGGGGTGGGTGGGG - Intergenic
1076692377 10:132230456-132230478 GCAGGAGGCCGCGGGTGCTGGGG - Intronic
1076705643 10:132299970-132299992 GCAGGAGTCCGCGGGGGTTTTGG - Intronic
1076946096 10:133651498-133651520 GCAGGGGCCGGGGTGGGGTGCGG - Intergenic
1077080309 11:722048-722070 GCAGGTGCCGGGGCGGGGCGGGG - Intronic
1077217669 11:1401815-1401837 GCAGGCGCCCTCGCGGGAGGAGG - Intronic
1078891301 11:15560935-15560957 GCAGGAACCCGGGCTGCGTGCGG + Intergenic
1079129582 11:17739722-17739744 GCAGGAGGCTGTGTGGGGTGGGG + Intronic
1079756779 11:24274365-24274387 GCAGGAGCCCACGGTGGGTGCGG + Intergenic
1079773676 11:24496950-24496972 GCTGGAGGCGGCGCGGGGAGAGG - Intronic
1080306371 11:30840693-30840715 GAAGGAGCCAGAGCAGGGTGAGG + Intronic
1080551375 11:33376317-33376339 GCAGGAGCCGGCCCGGGGGAGGG + Intergenic
1081700059 11:45147038-45147060 GACGGCGCCGGCGCGGGGTGGGG + Intronic
1083074267 11:60020340-60020362 GCAGGAGCCCACGGTGGGGGAGG + Intergenic
1083779066 11:64908932-64908954 GCAGGAACCCGGGCGGTGGGCGG + Intronic
1083845912 11:65333591-65333613 GCAGGAGCCGGGGCCGGGCGCGG - Intergenic
1084178629 11:67435909-67435931 GCAGGTCCCCGTGCGGGCTGAGG - Exonic
1084935292 11:72583686-72583708 GGAGGAACCGGCGCGGGGTCTGG - Intronic
1084956955 11:72696704-72696726 ACAGCAGCCCAGGCGGGGTGGGG - Intronic
1085303304 11:75471347-75471369 TCAGGAGCCGGCTGGGGGTGGGG - Intronic
1085954002 11:81368473-81368495 ACAGGAGCCCACGGTGGGTGGGG + Intergenic
1090709979 11:129375543-129375565 GCAGGAGTGTGCGCGCGGTGCGG - Intergenic
1090820492 11:130337477-130337499 GCAGGAGCCCACGCGGGGTGGGG + Intergenic
1092217925 12:6695445-6695467 GCTGGAGCCCCCTTGGGGTGGGG + Exonic
1092410907 12:8252312-8252334 GCAGGAGCCCACGGCGGGTTGGG + Intergenic
1096073575 12:48788944-48788966 GCCGGAGCCCGCGGGGGCGGCGG - Intronic
1096226213 12:49868379-49868401 GCAGGAGCCCGCTGGCAGTGAGG + Exonic
1096254947 12:50057299-50057321 GAAGGAGACAGCGCGGGGAGAGG + Intergenic
1097284272 12:57865473-57865495 GCTGGGGCCCTCGCGGGGCGCGG + Intergenic
1097719311 12:63002962-63002984 GCAGGAGCTTGAGCGGGGTAGGG - Intergenic
1099227433 12:79986526-79986548 GGAGGAGGCAGCGGGGGGTGAGG - Intergenic
1102197350 12:111034664-111034686 GCCGGAGCCCCAGCCGGGTGCGG - Intronic
1104713619 12:131002942-131002964 GCAGGAGCCGGCGATGGCTGGGG + Intronic
1104977759 12:132559932-132559954 GCGGGAGCGCGGGCGGGGCGGGG - Intronic
1108408357 13:50125627-50125649 CCAGGAGCCGGCGGGGGGAGGGG - Intronic
1108845709 13:54676849-54676871 GCAGGAGCCCACTGGGGGTGGGG - Intergenic
1109124886 13:58505508-58505530 GCAGGAGCCCACTGGGGGCGGGG + Intergenic
1111006683 13:82258240-82258262 GCAGGAGCCCACGGTGGGTCGGG - Intergenic
1113907012 13:113824055-113824077 TCAGGAGCACGCGCGGTCTGGGG + Intronic
1113907073 13:113824374-113824396 TCAGGAGCACGCGCGGTCTGGGG + Intronic
1114801908 14:25784695-25784717 GCAGGAGCCAAAGCAGGGTGAGG - Intergenic
1115118327 14:29909292-29909314 GCAGGAGCCCATGGGGGGCGGGG - Intronic
1115851707 14:37594840-37594862 GCTGGAGCCCGTGCCGGGGGAGG - Intronic
1116653805 14:47626793-47626815 GCAGGAGCCCACAGAGGGTGGGG - Intronic
1116900998 14:50362176-50362198 GCAGGAGCCCACGGTGGGGGTGG - Intronic
1119223841 14:72929119-72929141 AGAGGAGGCCGGGCGGGGTGGGG - Intronic
1119808677 14:77498908-77498930 GCACGGGGCCGCGCGGGGCGGGG + Intergenic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1122216490 14:100208247-100208269 GCAGGAGCCCCGGTGGGGAGCGG + Intergenic
1122275184 14:100587388-100587410 GCGGGAAGCCGGGCGGGGTGGGG - Intronic
1122937255 14:104965985-104966007 GCAGGGGCCCGCGCAGGCAGAGG - Intronic
1124491733 15:30162119-30162141 GCAGGAGGCAGCACGGGCTGCGG + Intergenic
1124685751 15:31780477-31780499 GCAGGAGCCGGCGGGAGCTGTGG + Intronic
1124751803 15:32376190-32376212 GCAGGAGGCAGCACGGGCTGCGG - Intergenic
1125081914 15:35684641-35684663 GCAGGAGCAAGAGAGGGGTGGGG + Intergenic
1125300735 15:38252157-38252179 GCCAGAGCGGGCGCGGGGTGGGG - Intergenic
1126639708 15:50812248-50812270 ACAGGAGCCCACGGAGGGTGGGG - Intergenic
1127674836 15:61228997-61229019 GCGGGAGCCCGGGCGCGGAGCGG - Intronic
1128028620 15:64460708-64460730 GCCGGAGCCGGGGTGGGGTGGGG + Intergenic
1128041087 15:64574026-64574048 GCAGGGGCAAGAGCGGGGTGTGG - Intronic
1128334472 15:66777310-66777332 GCAGGATTCCCCGTGGGGTGTGG + Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1129893758 15:79089393-79089415 CAGGGAGCCCGGGCGGGGTGGGG - Intronic
1130115592 15:81002079-81002101 GCGGGAGCCCGGGCGGCGCGGGG - Exonic
1130132902 15:81158901-81158923 ACAGGAGCCCACGGGGGGTGTGG - Intergenic
1132347842 15:101119149-101119171 GCAGGGCCCGGCGTGGGGTGGGG - Intergenic
1132382786 15:101378500-101378522 CCAGGAGCCCACACGGGGTAGGG - Intronic
1132580869 16:684137-684159 GCAGGCGCCCGGGCGGGCCGGGG - Exonic
1132601825 16:776207-776229 GGAGGAGCCCACCCAGGGTGGGG + Intronic
1132889157 16:2195824-2195846 GCAGGACCACGCTGGGGGTGTGG - Intronic
1133352131 16:5108632-5108654 GCAGGAGCCCACGGTGGGTGAGG + Intergenic
1134143698 16:11743063-11743085 GCAGGCGCCGTCGCGGGGCGTGG + Intergenic
1135545422 16:23362728-23362750 GCAGGAGGCTGCATGGGGTGTGG - Intronic
1136136960 16:28262094-28262116 GCAGGAGCCAGTGCTGGCTGGGG + Intergenic
1136707753 16:32202875-32202897 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136760156 16:32726536-32726558 GGGGGGGCCGGCGCGGGGTGAGG + Intergenic
1136807948 16:33143850-33143872 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1138026116 16:53523677-53523699 GCAGGAGCCCGGGAGGAGAGTGG - Intergenic
1139125502 16:64072409-64072431 ACAGGAGCCCACGGAGGGTGTGG + Intergenic
1139442338 16:66974508-66974530 ACAGGAGCCCACGGGGGGTGGGG - Exonic
1141522914 16:84593363-84593385 ACAGGAGACCCCGAGGGGTGAGG + Intronic
1142095055 16:88234954-88234976 GCAGGCGGCCGAGCGGGGTGGGG + Intergenic
1142249353 16:88983976-88983998 TAAGGAGCCCAGGCGGGGTGAGG + Intergenic
1142393392 16:89816772-89816794 GGAGGCGCCTGCGCGCGGTGAGG + Intergenic
1142605008 17:1076705-1076727 GCAGGTGCACGGGGGGGGTGGGG + Intronic
1142641616 17:1288675-1288697 TGAGGAGCCCGTGGGGGGTGGGG - Intronic
1143119278 17:4597064-4597086 GCAGGAGCCCGCTGAGGCTGGGG + Intronic
1143148007 17:4789222-4789244 CCAGGCGCCCGCTCGGGCTGCGG + Exonic
1143200712 17:5111496-5111518 GCAGGTGCCCGCCCGGGGAGGGG + Intronic
1143443921 17:6996231-6996253 GCTGCGGCCCGCGCGGGGCGAGG + Exonic
1143628028 17:8122071-8122093 GCAGGGGCCCGGCAGGGGTGAGG + Intronic
1144062729 17:11598482-11598504 GCTGGAGGCCGCGCGCGATGCGG + Exonic
1144185116 17:12789639-12789661 GCAGGAGGCGGCGCGGCGGGAGG + Exonic
1144427634 17:15158655-15158677 GAAGGAGTCTGCCCGGGGTGGGG - Intergenic
1145941463 17:28745290-28745312 GCAGGAGCCGGCCCAGGCTGTGG - Intronic
1147402484 17:40189317-40189339 AGAGGAGCCCGCGGGGCGTGAGG + Exonic
1148710611 17:49678139-49678161 GGAGGAGGCCGCGCGGGGTGGGG - Intronic
1148823234 17:50373098-50373120 GCAGTAGTCAGAGCGGGGTGAGG - Intronic
1149997079 17:61411111-61411133 GCAGCAACCCGGGTGGGGTGGGG + Intergenic
1150652766 17:67020528-67020550 GCAGAAGTCAGGGCGGGGTGGGG + Intronic
1151559162 17:74861545-74861567 GCCGGAGCCCGGGCGCGGCGGGG + Intergenic
1151866466 17:76806395-76806417 GCAGGAGCCCACGGCGGGGGCGG - Intergenic
1152537607 17:80959763-80959785 GCAGGCCTCCGCTCGGGGTGGGG + Intronic
1152541943 17:80981197-80981219 GCAGGAGCCTGCACAGGGTAGGG + Intergenic
1152565421 17:81098091-81098113 GGAGGGGCCAGCGGGGGGTGGGG + Intronic
1152629992 17:81406571-81406593 GGCGGAGCCCGAGCGGAGTGCGG - Intronic
1153052158 18:909349-909371 GAAGGCTCCCGCGTGGGGTGGGG + Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1154128724 18:11717026-11717048 GCAGGAGCCCATGGAGGGTGGGG + Intronic
1155053262 18:22165803-22165825 GCGGGAGCCGGCGCTGGGGGTGG + Intergenic
1156079538 18:33316469-33316491 GCAGGAGCCCACGGCGTGTGGGG - Intronic
1156683606 18:39618744-39618766 GCAGGAGCCCACGGGGTGGGGGG - Intergenic
1157061232 18:44292922-44292944 CCAGGAGCCTGCAAGGGGTGGGG + Intergenic
1157558659 18:48630965-48630987 GCTAGAGCCCGGGCTGGGTGCGG - Intronic
1157613855 18:48975723-48975745 GCAGGGACCCTCCCGGGGTGGGG + Intergenic
1158718339 18:59900211-59900233 GCTGGAGCCCGCGCGGGGCTCGG - Exonic
1159586597 18:70288834-70288856 GCCGGGGGCCGCGCGGGGCGGGG - Intergenic
1160024179 18:75205025-75205047 GCAGGAGCCCGCGGCGGCTCGGG + Intronic
1160543572 18:79638467-79638489 GCCGGGGTCCGCGCCGGGTGGGG + Intergenic
1160806925 19:996008-996030 GCTGGTGCCAGGGCGGGGTGAGG + Intronic
1160832192 19:1109228-1109250 GCATGAGCCTGGGCGGGGTCAGG + Intronic
1160994677 19:1877131-1877153 GTGGGGGCCGGCGCGGGGTGAGG + Exonic
1161029284 19:2050525-2050547 GCAGGAGCCCCCTCCGGGTCAGG - Intronic
1161069168 19:2251959-2251981 GCAGGAGTCCGCGCGGCGCAGGG - Exonic
1161169889 19:2807395-2807417 GGAGGAGCCCGCGAGGCGAGAGG + Intronic
1161294684 19:3513672-3513694 CCAGGAGCCCGCACGGGATGTGG + Intronic
1161312762 19:3603907-3603929 GCAGGGGCCCCCACGCGGTGGGG + Intronic
1161495372 19:4583492-4583514 GCAGGACACGGGGCGGGGTGGGG - Intergenic
1161550390 19:4909434-4909456 GCAGGAGGCCGTGCCGGGGGCGG - Exonic
1161820925 19:6531086-6531108 GCAGGCGCGAGCGCGGGGCGCGG - Exonic
1162095660 19:8308347-8308369 GCACGCGCACGCGCGGGGTTGGG + Exonic
1162339855 19:10086014-10086036 GGGGGAGCGCGCGCTGGGTGGGG + Intergenic
1162547561 19:11339629-11339651 GGCGGAGCCCGCGCGGGATCCGG - Exonic
1163727214 19:18929535-18929557 GCGGGAGCGGGCGCGGGCTGAGG - Exonic
1165682649 19:37790701-37790723 CCAGGGTCCCGCGCGGGCTGCGG - Intronic
1166310320 19:41958941-41958963 GCAGGGTCCTGCGGGGGGTGGGG + Exonic
1167284076 19:48589030-48589052 GGAGGAGCCCGAGCGGGCTTAGG + Intronic
1168272682 19:55258592-55258614 GCAGGCGCCCGCGGGTCGTGGGG + Exonic
1168317337 19:55490023-55490045 GCAGGAGGGCACGCTGGGTGGGG - Intronic
1168317361 19:55490079-55490101 GCAGGAGGGCACGCTGGGTGGGG - Intronic
1168347026 19:55654931-55654953 GGCGGAGCCCGGGCGGGGCGGGG + Intronic
1168703712 19:58456261-58456283 GCAGGAGCTGGTGCTGGGTGAGG - Exonic
1168706220 19:58471809-58471831 GCAGGAGCTGGTGCTGGGTGAGG - Exonic
925120726 2:1415808-1415830 GCAGGAGGCTGGGCTGGGTGTGG - Intronic
925736636 2:6969474-6969496 GCAGGAGCATGAGCAGGGTGTGG - Intronic
926097529 2:10091697-10091719 GCAGGAGCCCATGGCGGGTGGGG - Intergenic
926154822 2:10448057-10448079 GCGGGAGCCGGGGCGGGCTGCGG - Intronic
926227365 2:10977829-10977851 GCAGGAACACGCTCGGGTTGGGG - Intergenic
926850683 2:17193791-17193813 ACAGGAGCCCACGGAGGGTGGGG - Intergenic
928314064 2:30232405-30232427 GAAGGAGCCCGGGCCGGGCGCGG + Intronic
929137985 2:38643151-38643173 GCTGGAGCCCACCAGGGGTGGGG + Intergenic
931691095 2:64835495-64835517 GCATGAGCCACCGCAGGGTGGGG + Intergenic
932180716 2:69643750-69643772 GCGGGAGCGCGCGCGGGGGAGGG - Intronic
932345829 2:70994651-70994673 GCGGGAGCCCGCGCGGGCCGGGG + Intronic
937150989 2:119685491-119685513 GCAGGAGGCCTCGCCGGGTGAGG - Intronic
937989939 2:127656759-127656781 GCAGGAGCCACCTCGGGGTGTGG - Intronic
938864380 2:135403132-135403154 GCAGGAGCCGAAGCTGGGTGAGG + Intronic
939630803 2:144524335-144524357 GCAGGATCCCGGGCGGGGACAGG - Intronic
942116764 2:172735824-172735846 GCGGGAGCCCGCGGGGAGGGCGG + Exonic
942151015 2:173076014-173076036 GCTGGAGCCCGCGGAGGGCGGGG + Intronic
942803380 2:179901855-179901877 GCAGGAGCAAGTGCAGGGTGGGG + Intergenic
943941410 2:194002821-194002843 GCAGGAGCCCACGGTGGGTGGGG + Intergenic
946054029 2:216885504-216885526 GCAGGAGCCCACGGTGGGGGCGG - Intergenic
946395454 2:219441932-219441954 GCGGGAGCCGGCGCGGGTGGCGG - Intronic
947937990 2:234024360-234024382 GCAGGAGCCCACGGCGGGCGAGG + Intergenic
948140862 2:235670837-235670859 GCTGGAGCGCGCGCGGGCGGCGG + Intronic
948402292 2:237692609-237692631 GCAGGTGCCCGGGAGGCGTGGGG + Intronic
948473785 2:238203617-238203639 GCTGCCGCCCGCCCGGGGTGTGG - Exonic
948499721 2:238383001-238383023 GCTGGAGCCCGAGAGTGGTGAGG - Intronic
948844403 2:240676311-240676333 GAAGGAGCCCGCGGGAGATGGGG + Intergenic
948849457 2:240698568-240698590 GAAGGAGCCCGCGGGAGATGAGG - Intergenic
949058950 2:241945477-241945499 GCCGGAGCCCGCGGTGGGAGTGG + Intergenic
1168750754 20:279427-279449 GCAGGAGGCCGCACGGGGGCGGG - Intronic
1168771981 20:421292-421314 GCAGGAGCCCGGGCGGCGAAAGG - Intronic
1168855082 20:1002396-1002418 CCGGGAGCGCGCGCGGGGAGGGG + Intergenic
1169252124 20:4068863-4068885 GCAGGAGACAGGGTGGGGTGGGG + Intergenic
1173067820 20:39729782-39729804 GCAGGAGCAAGTGGGGGGTGGGG - Intergenic
1173213230 20:41054293-41054315 GCAGGTGCGGGGGCGGGGTGGGG - Intronic
1174446940 20:50596823-50596845 GCAGAAGCCCTCGGGGGCTGGGG + Intronic
1175305550 20:57973406-57973428 ACAGGAGCCGGGGTGGGGTGGGG + Intergenic
1175443768 20:59007176-59007198 GCGGGAGCCGGCGCGGGATCTGG - Exonic
1175877809 20:62238672-62238694 GCTGGAGCCGGGGCGGGGAGGGG + Intronic
1176016718 20:62937749-62937771 GCGTGAGGCCGCACGGGGTGGGG - Intronic
1176414649 21:6467647-6467669 GGAGGGGCCCGGGCTGGGTGGGG - Intergenic
1178872118 21:36385593-36385615 GGAGGAGGCCGCGCGGGGCCGGG - Intronic
1179225094 21:39445854-39445876 GCAGGAGCCGCGGCGGGGAGGGG + Intronic
1179655521 21:42842085-42842107 GCAGGTGACCGGGCGGGCTGTGG + Intergenic
1179690149 21:43075969-43075991 GGAGGGGCCCGGGCTGGGTGGGG - Intronic
1179891673 21:44338768-44338790 GGAGGAGCCGGGGCGGGGCGGGG - Intronic
1179891752 21:44338952-44338974 GGAGGAGCCGGGGCGGGGAGAGG - Intronic
1179891781 21:44339022-44339044 GGAGGAGCCGGGGCGGGGAGAGG - Intronic
1179891796 21:44339057-44339079 GGAGGAGCCGGGGCGGGGCGAGG - Intronic
1179985619 21:44919108-44919130 GCAGGTGACCGGGCGGGCTGTGG - Intronic
1180166525 21:46033586-46033608 CCAGGAGGCAGCACGGGGTGCGG + Intergenic
1180166544 21:46033639-46033661 CCAGGAGGCAGCACGGGGTGTGG + Intergenic
1181037271 22:20175765-20175787 GCAGGGGCCAGCGGGGGATGGGG + Intergenic
1181051164 22:20238900-20238922 CCAGCAGCCCGCATGGGGTGGGG + Intergenic
1181636175 22:24175881-24175903 GGAGGAGCCCTCTGGGGGTGGGG + Intronic
1181711741 22:24695705-24695727 GCAGGAGCCTGCGCTGGGTCAGG - Intergenic
1181956357 22:26590128-26590150 GGAGGTGCCCGCGCGGGGGCGGG + Exonic
1183149690 22:36028221-36028243 GCAGGTGACCGCGCGGGACGGGG - Exonic
1183539733 22:38423116-38423138 GCAGGAGCCGGAGTGGAGTGAGG + Intergenic
1183689739 22:39381962-39381984 GCAGGAGCAGGGGCTGGGTGTGG - Exonic
1183903188 22:41021685-41021707 GCAGGAGGCCGGGCGGGGCGGGG - Intergenic
1185043660 22:48518198-48518220 GCAGGAGCCCACGTGGGATCTGG + Intronic
950530386 3:13549435-13549457 ACAGAGGCCGGCGCGGGGTGGGG + Intronic
950583965 3:13880012-13880034 GGAGGAGCGAGCGCGGCGTGGGG + Exonic
951332920 3:21387332-21387354 GCAGGAGCCCACGGCGGGTGGGG + Intergenic
951544479 3:23810791-23810813 TCGGGGGCGCGCGCGGGGTGGGG + Intronic
953307573 3:41844249-41844271 ACAGGAGCCCGCGGAGGGGGTGG + Intronic
953414070 3:42705579-42705601 GCAGGTGCCCTGGCGGGTTGAGG - Intronic
953908630 3:46881352-46881374 GGAGGAGTCCGCGGGGGTTGGGG - Intronic
954200607 3:49021292-49021314 GCTGGCCCCCGCGCGGGGTTTGG - Exonic
954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG + Exonic
955927675 3:64023578-64023600 GCAGGCGCCCAGGCCGGGTGAGG - Intronic
956640878 3:71414321-71414343 GCAGGGCCCCGAGCTGGGTGTGG - Intronic
957056140 3:75444535-75444557 GCAGGAGCCCACGGAGGGTTGGG + Intergenic
957209464 3:77240432-77240454 GCAGGAACCCGGGCTGTGTGCGG - Intronic
962722311 3:138187508-138187530 GCAGGCGCCGGCGCGGGGGCCGG - Exonic
964378552 3:156073396-156073418 GCAGGAGCCCACGCAGGGAGGGG - Intronic
965535740 3:169822272-169822294 GCCGGAGCTCGCGCAGGGCGTGG - Exonic
966762139 3:183428148-183428170 ACGGGAGCCCCCGCGGGGCGTGG - Exonic
968511385 4:997373-997395 GGGGGAGACCGCGCGGGGTGGGG - Intronic
968894122 4:3388739-3388761 ACAGGAGCCTGGGCGGGGTCGGG + Intronic
968923049 4:3532480-3532502 CCAGGAGACCGCGCGGTGGGTGG - Exonic
968951898 4:3699772-3699794 GCAGGGACCCGCGGGTGGTGAGG + Intergenic
968998949 4:3964816-3964838 GAAGGAGCCCACGAGGGTTGGGG + Intergenic
969698094 4:8747379-8747401 GCAGGAGCCGGGGCAGTGTGTGG + Intergenic
973091117 4:46137566-46137588 GCAGGAGCAAGAGAGGGGTGGGG - Intergenic
976158688 4:82175567-82175589 GCATGAGCCCAAGCAGGGTGAGG + Intergenic
977883633 4:102234619-102234641 GCAGGAGCCCATGGGGGGTTGGG - Intergenic
978207160 4:106092479-106092501 GCAGGAGCCCACGGTGGGTTGGG + Intronic
978577066 4:110198450-110198472 GCTGGAGACCGAGCGGCGTGGGG - Intronic
979224225 4:118265834-118265856 GCAGGAGCCCAGGTGGGGGGAGG - Intergenic
983076454 4:163332298-163332320 GCAGGAGCCCGCGAACGGTCCGG + Intronic
985449506 4:190052152-190052174 GCAGGGGCCGGGGTGGGGTGCGG - Intergenic
985713713 5:1444652-1444674 GCAGGAGGCCGCGTTGGGAGAGG + Intronic
988369297 5:30346033-30346055 ACAGGAGCCCACGGGGGGCGGGG - Intergenic
988883632 5:35531908-35531930 ACAGGAGCCCACGCAGGGGGAGG - Intergenic
989544711 5:42659782-42659804 GCAGGAGCCGAAGCAGGGTGAGG + Intronic
990869954 5:60420722-60420744 GCGGGAGCCAGCGCAGGGTGGGG + Intronic
994710538 5:103259195-103259217 GGTGGGGCCCGCGCGGGGTGCGG + Intronic
995438043 5:112159990-112160012 GCTTGAACCCGGGCGGGGTGGGG - Intronic
997461056 5:134052824-134052846 GCAGAAGCCCTGGCCGGGTGCGG + Intergenic
997625305 5:135327135-135327157 AGAGAAGCCCGCGCGGGCTGGGG + Intronic
998957634 5:147453727-147453749 GCGGGAGCCCGGGAGGGGGGCGG - Intronic
999372587 5:151064815-151064837 GCAGGAGCCAGCGCTGGGCCAGG + Intronic
1002159622 5:177307561-177307583 GCAGAGGCCCGCCCTGGGTGAGG + Exonic
1002524073 5:179806132-179806154 GCAGGAGCTGGGGCGGCGTGAGG - Intronic
1003097916 6:3156880-3156902 GCAGGTGACTGCGCTGGGTGGGG - Intronic
1003784507 6:9469740-9469762 GCAGGAGCTCTGGCCGGGTGCGG + Intergenic
1004053115 6:12108469-12108491 GCAGGAGCCCACGGAGGGGGTGG + Intronic
1005059323 6:21761442-21761464 ACAGGAGCCCACGGGGAGTGGGG - Intergenic
1005334019 6:24775273-24775295 GCGGGAGCCGGGGCGGGGTTGGG + Intronic
1005826053 6:29632533-29632555 GCGGAGCCCCGCGCGGGGTGGGG + Intronic
1005958250 6:30679433-30679455 GGAGAAGCCCGCGGGGGTTGAGG + Intronic
1006230820 6:32584675-32584697 GGAGGAGGCGGCGCGGGCTGCGG - Intronic
1007479795 6:42142449-42142471 CCTGGCGCCCGCGCGGGCTGCGG - Intronic
1007516806 6:42419256-42419278 GCAGAAGCCGGGGCGGGGGGTGG - Intronic
1007784266 6:44270981-44271003 GCAGCGGCCGGCTCGGGGTGCGG - Intronic
1010794882 6:80106943-80106965 GCAGGCGCCCGCGAGGGGCAGGG + Intronic
1011685379 6:89819618-89819640 GCAGGTGGCCGCTCGGGGTGAGG - Exonic
1013591497 6:111622711-111622733 GCAGTGGCCCGTGTGGGGTGGGG + Intergenic
1015724819 6:136289438-136289460 ACGGGAGGCCGCGCGGGCTGTGG + Intronic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1018028806 6:159826121-159826143 GCAGGAGCCGGCGCTGGGGCCGG + Intergenic
1018613037 6:165662119-165662141 GGGGGAGCCCGCGCGGCGGGCGG + Intronic
1019094383 6:169567076-169567098 GCAGCAGCCCGAGCCAGGTGGGG + Intronic
1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG + Intronic
1019387777 7:768084-768106 GCGGGAGCTCGCGCTGGGAGCGG + Intronic
1019387796 7:768198-768220 GCAGGAGCTCGCACTGGGAGGGG + Intronic
1019453220 7:1110398-1110420 GGAGGTGCCGGCGCGGGGAGAGG - Intronic
1021513767 7:21461277-21461299 GCAGGAGCCCACGGGGGTTGGGG + Intronic
1022629363 7:32070853-32070875 GCGGGAGCCGGCGCGGGCGGTGG + Intronic
1023113852 7:36841220-36841242 GTAGGAACCTGGGCGGGGTGGGG - Intergenic
1023883506 7:44334965-44334987 GCAGGAGCCCGGCCAGGCTGGGG - Intergenic
1024465938 7:49711534-49711556 ACAGGAGCCCACGGAGGGTGGGG - Intergenic
1025173971 7:56787550-56787572 GCAGGAGCGCGAGGGGGCTGTGG - Intergenic
1025698129 7:63790405-63790427 GCAGGAGCGCGAGGGGGCTGCGG + Intergenic
1025829850 7:65038875-65038897 GCAGGAGCGCGAGGGGGCTGCGG + Intergenic
1025917102 7:65873875-65873897 GCAGGAGCGCGAGGGGGCTGCGG + Intronic
1026849790 7:73717564-73717586 GCAGGAGCCCACCCGGGGTGGGG - Intronic
1026850377 7:73719751-73719773 GGCGGGGCCCGGGCGGGGTGGGG - Intergenic
1026968299 7:74453935-74453957 GCCGCAGCCCGCGCCGGGGGTGG + Intronic
1027778985 7:82499851-82499873 GCAGGAGCCCACGGTAGGTGGGG - Intergenic
1027956074 7:84880808-84880830 GCAGGAGCCCACGGCGGGGGAGG - Intergenic
1029730248 7:102433815-102433837 GCGGGATCCCTGGCGGGGTGCGG + Intronic
1029903992 7:104072041-104072063 ACAGGAGCCCACGGTGGGTGGGG - Intergenic
1029988198 7:104940434-104940456 CCAGGAGCCCACGGAGGGTGGGG - Intergenic
1030262457 7:107580175-107580197 GCGGGAGCCTGCGGGGCGTGAGG + Intronic
1030980662 7:116182062-116182084 GCAGGAGCCCACGGGGGTGGGGG + Intergenic
1033220476 7:139523892-139523914 GCAGGAGCGCGGGCGCGGCGCGG + Exonic
1034164127 7:149012787-149012809 CCAGGAGCCCACGGGAGGTGGGG + Intronic
1034414116 7:150955912-150955934 GCAGGAGCCTGGGCGGGCTGCGG - Intronic
1034469782 7:151248971-151248993 GCGGGAGGCGGCGCGGGGAGGGG + Exonic
1035171427 7:157019409-157019431 GTAGGAGTCTGCGCTGGGTGCGG - Intergenic
1035475964 7:159144599-159144621 GCTGGAGCGCGGGCGGGGTCCGG - Intronic
1035703012 8:1651597-1651619 GCAGGAGCCCGGCAGGAGTGGGG - Intronic
1036485183 8:9173043-9173065 GCAGGAGCATGTGCTGGGTGGGG - Intergenic
1036554630 8:9847879-9847901 GCAGGAGCCCACGAGGGTGGGGG + Intergenic
1036587371 8:10136715-10136737 GCAGGAGCCCACTCGGGGTCAGG + Intronic
1036785295 8:11681463-11681485 CCCGGTCCCCGCGCGGGGTGCGG + Intronic
1036851284 8:12203484-12203506 GCAGGAGCCCACGGCGGGTTGGG + Intergenic
1036872648 8:12445758-12445780 GCAGGAGCCCACGGCGGGTTGGG + Intergenic
1038445072 8:27598082-27598104 GCAGGATCCAGAGCGGGGAGAGG + Exonic
1038696623 8:29812307-29812329 GCAGGATCCCTTGTGGGGTGGGG - Intergenic
1039068771 8:33631961-33631983 GCAGGAGCCCACGGTGGGTATGG - Intergenic
1040807458 8:51409391-51409413 GCAGCAGCCCACGTGGGGCGCGG - Exonic
1041068570 8:54104476-54104498 GCAGGAGCCCACGGCGGGGGCGG - Intergenic
1041281036 8:56211419-56211441 GGCGGAGCGCGCGCGGGGGGCGG - Intergenic
1044441680 8:92231054-92231076 GCAGGAGCCCACGGTGGGTGGGG - Intergenic
1044591622 8:93917859-93917881 GCTGCTGCCCGCGCGGGTTGTGG + Intronic
1045336151 8:101205751-101205773 GCAGGCGTGCGAGCGGGGTGGGG - Intronic
1045701295 8:104869884-104869906 GCAGGAGCCAGGGAGAGGTGTGG + Intronic
1047100156 8:121667525-121667547 GCAGGAGCCCCCGGCGGGGGCGG + Intergenic
1047203168 8:122782714-122782736 GGGGGAGTCCGCGCGGGGCGGGG + Intronic
1047292281 8:123541101-123541123 GCAGGGGCCCGCGACGGGGGCGG + Exonic
1049005702 8:139854366-139854388 GCAGGAGCCCACGCTGGGGCAGG + Intronic
1049396350 8:142402953-142402975 GCGGGAGGCCGGGCGGGGGGCGG - Intronic
1049444598 8:142624223-142624245 GCTGGAGACCGCGCGAGGCGGGG - Intergenic
1049452505 8:142669798-142669820 GCAGGCGGGCGCGCGGGGCGGGG - Intronic
1049651312 8:143771234-143771256 GCAGGATCCCCGGCGGCGTGGGG + Intergenic
1049661525 8:143821745-143821767 GCAGGGGCAGGGGCGGGGTGCGG - Intronic
1049708891 8:144054952-144054974 GCAGGGGCCAGAGCGGGGTGGGG + Intronic
1049744723 8:144258408-144258430 GCAGGAACAGGCCCGGGGTGGGG + Intronic
1049762720 8:144338288-144338310 GCAGGCGCTCCCGAGGGGTGGGG + Intergenic
1055654972 9:78442354-78442376 GCAGGAGCCCACGTTGGGGGTGG - Intergenic
1055862733 9:80772406-80772428 GCTGCAGCCTGCGTGGGGTGAGG + Intergenic
1055985493 9:82054461-82054483 GCAGGAGCCCACGGTGGTTGGGG + Intergenic
1057619037 9:96619158-96619180 CCAGGGCCCCGCGCCGGGTGCGG + Intronic
1057723775 9:97554178-97554200 GCAGGAGGGTGGGCGGGGTGGGG + Intronic
1057757089 9:97847541-97847563 GCAGGAGCGCCCGCTGGGAGCGG + Intergenic
1059270547 9:113067984-113068006 GCAGGACCCGGCGGGGTGTGGGG + Intergenic
1059272815 9:113078878-113078900 GCAGGACCCGGCGGGGTGTGGGG + Intergenic
1059273949 9:113084320-113084342 GCAGGACCCGGCGGGGTGTGGGG + Intergenic
1059275084 9:113089764-113089786 GCAGGACCCGGCGGGGTGTGGGG + Intergenic
1059415002 9:114156819-114156841 GCTGGAGCCGGCGCAGCGTGTGG + Intronic
1060182914 9:121546208-121546230 GCAGGAGGACCCGCGGGGCGGGG + Intergenic
1060643968 9:125262168-125262190 GCAGGAGCCAGGGCGGCCTGGGG + Intronic
1061286434 9:129626064-129626086 TCCGGAGCCCGCGCGGGGGAGGG + Intronic
1061330643 9:129890265-129890287 TCAGTGGCCTGCGCGGGGTGGGG + Exonic
1061772531 9:132937151-132937173 GCAGGAGCCCAGGCCAGGTGTGG + Intronic
1061956064 9:133961913-133961935 GCAGGGGCCACCGTGGGGTGAGG - Intronic
1061976099 9:134068535-134068557 GCGGGAGCGCGCGCGCGGGGCGG + Intronic
1062269385 9:135701697-135701719 GCCGCAGCCTGCGGGGGGTGTGG + Intergenic
1062349936 9:136133549-136133571 GCAGGAGCACAGGCGGGGGGTGG + Intergenic
1062452975 9:136623269-136623291 GCATGAGCCCACGGTGGGTGTGG - Intergenic
1062577046 9:137213730-137213752 GCTGGAGCCCGGGCGGAGAGTGG - Intronic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1186434118 X:9528678-9528700 GCAGGAGCTTGCGGGGGGAGGGG + Intronic
1190714653 X:53093356-53093378 GCCGGAGCGCGCGAGGGGTGGGG + Intergenic
1190714833 X:53094338-53094360 GCCGAAGCGCGCGAGGGGTGGGG + Intergenic
1190977972 X:55426696-55426718 GCATGAGCCAACGCAGGGTGAGG + Intergenic
1196319499 X:114270641-114270663 ACAGGAGCCCACGGAGGGTGTGG + Intergenic
1197607971 X:128606905-128606927 ACAGGAGCCCACGCGGGAGGGGG - Intergenic
1198533327 X:137565775-137565797 CAAAGAGCCCGCGAGGGGTGGGG + Intergenic
1200134761 X:153869547-153869569 GCAAGAGCCCGTGCCGGTTGCGG + Exonic
1201545655 Y:15158868-15158890 GCATGAGCCCAAGCAGGGTGAGG - Intergenic
1202395126 Y:24415359-24415381 GCAGGAGCCAAAGCAGGGTGAGG - Intergenic